river on mirror

Waiting for the new riveron

2008-01-09T10:19:00.000-08:00

Soon a new riveron experience...

City, Ecology, Mobility - With Mitch Joachim, Terreform 1

2007-12-15T18:47:00.001-08:00

NAICA CRYSTALS

2007-11-01T22:06:00.000-07:00

the true intuition that among Gaia´s body there are more mysteries and awesome awaitings, why not live in a cave? hey, live in a quartz. live among the soft precious spots of her body. those that make u eerie or peaceful. wouldnt you like to lay near (and not far away,) from a nice mystic girl (meet her in a highway, take her to Hawai) and know her secrets.

"Mothlight" Stan Brakhage (1963)

2007-10-08T18:18:00.001-07:00

sol all sun

2007-09-18T14:48:00.001-07:00

Poetry - Robert Anton Wilson

2007-09-17T13:13:00.001-07:00

Dove sta memora

You have not snared her,

She's in my pulse,

    Eye sees only

Brain conceives

Brain knows more

Brain can scan

Scarecrow Death:

My heart, my breath.

Local hardware;

Nonlocal software;

Than eye can see:

Eternity.

in covnant garden

2007-08-18T02:03:00.000-07:00

Jus now i had a conversation with Thomas De Quincey
in the Magnificent Seven, Old Brompton actually
talking crows talking clouds
as i dazed off in a bench with shrieking twilight
and the trees of Lady Anne, sweet lady Anne
so like a cloud that pervails time
face forming in a river or dream
Lady Anne
saw her near the graffiti glows
witha gentle hand fading like the skies
above the London Town.

Thomas told me that the opium underground
lives like tube dreams that tunnel streching through
new strobes and oyster cards. Bespeaking of
a gray light that never dies.
I said that i am postmodern brat but even so
i like to surf the clouds with a wicked eye.
He would not defer but still i knew we were the same
woefully, passing by like Stendhals glass.
So mate rememember what the dragon said
to the shadow, you are my house and iam thee light.

IN FLUX

2007-08-03T06:52:00.001-07:00

north carolina made videoart- colors in a steamglass and fractal heat faces

time is out of time is out

2007-07-25T17:54:00.001-07:00

Powers of Ten

2007-07-23T13:02:00.001-07:00

an exponential hermes-mirror showing the updown voyage of the micromacro mirror

Bey's Poetic Terrorism

2007-07-07T21:28:00.000-07:00

"WEIRD DANCING IN ALL-NIGHT computer-banking lobbies. Unauthorized pyrotechnic displays. Land-art, earth-works as bizarre alien artifacts strewn in State Parks. Burglarize houses but instead of stealing, leave Poetic-Terrorist objects. Kidnap someone & make them happy. Pick someone at random & convince them they're the heir to an enormous, useless & amazing fortune--say 5000 square miles of Antarctica, or an aging circus elephant, or an orphanage in Bombay, or a collection of alchemical mss. Later they will come to realize that for a few moments they believed in something extraordinary, & will perhaps be driven as a result to seek out some more intense mode of existence.

Bolt up brass commemorative plaques in places (public or private) where you have experienced a revelation or had a particularly fulfilling sexual experience, etc.

Go naked for a sign.

Organize a strike in your school or workplace on the grounds that it does not satisfy your need for indolence & spiritual beauty.

Grafitti-art loaned some grace to ugly subways & rigid public momuments--PT-art can also be created for public places: poems scrawled in courthouse lavatories, small fetishes abandoned in parks & restaurants, xerox-art under windshield-wipers of parked cars, Big Character Slogans pasted on playground walls, anonymous letters mailed to random or chosen recipients (mail fraud), pirate radio transmissions, wet cement...

The audience reaction or aesthetic-shock produced by PT ought to be at least as strong as the emotion of terror-- powerful disgust, sexual arousal, superstitious awe, sudden intuitive breakthrough, dada-esque angst--no matter whether the PT is aimed at one person or many, no matter whether it is "signed" or anonymous, if it does not change someone's life (aside from the artist) it fails.

PT is an act in a Theater of Cruelty which has no stage, no rows of seats, no tickets & no walls. In order to work at all, PT must categorically be divorced from all conventional structures for art consumption (galleries, publications, media). Even the guerilla Situationist tactics of street theater are perhaps too well known & expected now.

An exquisite seduction carried out not only in the cause of mutual satisfaction but also as a conscious act in a deliberately beautiful life--may be the ultimate PT. The PTerrorist behaves like a confidence-trickster whose aim is not money but CHANGE.

Don't do PT for other artists, do it for people who will not realize (at least for a few moments) that what you have done is art. Avoid recognizable art-categories, avoid politics, don't stick around to argue, don't be sentimental; be ruthless, take risks, vandalize only what must be defaced, do something children will remember all their lives--but don't be spontaneous unless the PT Muse has possessed you."

"Dress up. Leave a false name. Be legendary. The best PT is against the law, but don't get caught. Art as crime; crime as art."

FSOL'S

2007-07-07T19:30:00.001-07:00

2007-06-20T20:33:00.000-07:00

"When there is a choice of either living or dying, as long as there remains nothing behind to blemish one´s reputation, it is better to live"

-010
paradox
-11010

"Where there is a choice of either going or not going, it is better not to go"

-1001101
paradox mirror paradox
- 010

"Where there is a choice of either eating or not eating, it is better not to eat. Where there is a choice of either dying or not dying, it is better to die."

-

boards of canada - dayvan cowboy

2007-06-09T12:21:00.001-07:00

river eyes quote on mirror sun

2007-05-21T14:37:00.000-07:00

Instead of the usual hypothesis that seeing implies a one-way process, consider it implies a two-way process. At the same time that light enters the eyes, the images and the perceptions are projected outside into the world around us. What we perceive are mental constructs, which imply the interpretative activity of our mind. But while we have images in our mind, this images are also outside our organism. If they exist both inside the mind and outside the body, the mind must extend outside the body. Our mind extends itself and touches all that we see. If we look at far away stars,our mind extends through astronomical distances until it touches their celestial bodies. Subject and object undoubtedly mix. Through what we perceive, what surrounds us enters us, but we also extend ourselves outside into the environment. -Rupert Sheldrake

(for a more extensive look at Mr. Sheldrakes experiments on "The Sense Of Being Stared At" check sheldrake.org)

...consider seeing as a double-flux embedded on as crystal feedback... we transform raw frequencies of light into coherent color images that we play on our brains, but we also transform raw reality by re-emitting the light of the images we have formed, thus re-producing the tone and qualia of our perceptions on to nature... in this way realty is constructed by a sort of ping-pong between the light of the sun and the eyes which work as an open mirror... this could help explain why paradigmatic views have such a determinant effect over reality: why people who share certain conditions perceive the world around very much the same and why people who do not share those conditions but participate in another world-mindframe (a sort of visionary tradition that inhabits the world through repetition) perceive the physical world so differently... and most importantly, that by looking at the world we transform it, we ingrain on it the soft radiance of our thoughts and paint the sky,
as the ancients used to say:
the eye is the sun, the sun: the eye

Dennis Gabor: Father of Holography

2007-05-18T16:37:00.001-07:00

Dennis Gabor (Gábor Dénes) ,FRS, (June 5, 1900, Budapest – February 9, 1979, London) was a Hungarian physicist and inventor, most notable for inventing holography, for which he later received the Nobel Prize in Physics.

Holography is a lens-less type of photography in which a wave field of light scattered by an object is recorded as an interference pattern on a plate. In holography the total of all the information has to be used; not only the amplitude, as in usual optical imaging, but also the phase. In this manner a complete holo-spatial picture is obtained.

An electromagnetic energy hologram is defined as the whole (or entire) 3-D message contained in a beam of light, compared with the partial message obtained in an ordinary two-dimensional (2-D) photograph.

When Gabor first invented holography he did not produce actual holograms which had to wait until the invention (in 1962) of the laser (light amplification by stimulated emission of radiation) as no coherent light source existed at the time.

"The best way to predict the future is to create it", Dennis Gabor

Other practical uses include:

Holographic data storage: a technique that can store information at high density inside crystals or photopolymers. As current storage techniques such as Blu-ray reach the denser limit of possible data density (due to the diffraction-limited size of the writing beams), holographic storage has the potential to become the next generation of popular storage media.

Holograms can be made using sound waves and other waves in the electro-magnetic spectrum. Holograms made with X-rays or ultraviolet light can record images of particles smaller than visible light, such as atoms or molecules. Microwave holography detects images deep in space by recording the radio waves they emit. Acoustical holography uses sound waves to "see through" solid objects.

Higher order holographic image events that involve dynamic movement or energetic activities which produce changes in material or nonmaterial space through time are reconstructed from energetic holograms having at least four dimensions (4-D).

NASA, Bell Labs and SONY are some of the companies at the cutting edge of holographic implementation. Its uses and applications are too numerous to enlist...

"The three-dimensional reality interested artists from the age of Velasquez; presently analytical cubism of Picasso has tried to take possession of Velasquez's 3-D reality. Now, due to the genius of Gabor, holography has made possible art renaissance, and the doors of a new area of creativity have opened ahead of me", Salavdor Dali.

Informational universe theoreticians have hypothesized that a sufficiently advanced civilization could record the entirety of its history and experience, both qualitative and quantitative in a single holographic plate no bigger than a grain of sand. Of course it has also been sustained by mystics of all the ages that this is exactly what the universe does at all times and that one can access the recordings of time past and time future just by looking into a molecule of pure air (akasia oracle).

********************************

Gabors discovery elegantly transcends the field of applied science, in the way of old-school harmonics it reflects beautifully a cosmic pattern of organizing information. His work has been continued by the likes of David Bohm and Karl Pribram, who have added a quantum dimension where mind and space are seen as a holonomimicaly transforming entity in which subatomic particles and memory (as bits or memes) are at all times a reflection of the totality, in themselves containing and interconnecting the totality of all information and consciousness as basic energy unfolding from the unfathomable ocean of implicate unity.

Gabor should certainly feel good (aetherial sunny smile) for networking the tools that give imagination its conceptual grounds and avail the formation of an image unparalleled in the history of mankind. The realization of the heartfelt intuition that inspired William Blake when he said:

To see a world in a grain of sand
and a heaven in a wild flower,
to hold infinity in the palm of your hand
and eternity in an hour.

http://universal-hologram.com/

seven experiments that could change the world

2007-05-04T13:17:00.000-07:00

Keystone questions to a deeper understanding of our world, posed by Rupert Sheldrake:

1.How do pets know when their owners are returning?
2.How do pigeons know how to return to their homes?
3.How do termites in a colony communicate?
4.How does one know when one is being stared at from behind?
5.How can a person feel parts of missing limbs when these parts have been removed by amputation or accident?
6. How constant are fundamental constants?
7. What role does expectation play in obtaining the results of experiments?

Tokyo Tower 2 (Hologram Museum)

2007-05-03T12:18:00.001-07:00

a visit to the hologram museum in techno-tokyo, scary-apparel-eyes goblin apparitions porcelain skin and a sort of elegance, for video aficionados and hologram dilettantes

Carina Nebula

2007-04-26T10:11:00.000-07:00

Celebrating Hubble Telescope 17th anniversary: one of the largest panoramic images taken with Hubble´s cameras. It is a 50-light-year-wide view of the central region of the Carina Nebula where a maelstrom of star birth - and death - is taking place.

As Milton said, a work "of the god that hangs the stars at night".

It also has a certain hue reminder of the great mirror-crown-wars depicted on the walls of Bonampak.

http://hubblesite.org/newscenter/archive/releases/2007/16/image/a/

2007-04-08T20:09:00.000-07:00

"Bitter
.
But
.
Blue
.
Butter"
...

open the oven of the stars

2007-03-29T13:43:00.002-07:00

Information is accelerating at synchromystical speed. A strange light in the sky.

A process of de-hermetization is taking place। But this opening of the secrets may also have the face of an overflow, of a racing strategy to form a new puzzle in the worldscreen (toppling with undertones). Today is UFO day in the river, which also means its fun (speculorum); in adding order to the mirror we transcribe some useful ludus memes as theoretical maps in the escathopolitical dreamscape.

In probing the Other we shall always come back with images of ourselves। In probing ourselves we shall return with images of the Other. In the phenomenon of being itself no less than in the phenomenon of the UFO encounters we are merely privileged observers of a relationship between what is naively called the world and the transpersonal portion of the human psyche. How this relationship came to be, and what its limitations are, we cannot know until we gain access to the transpersonal and a-temporal part of the psyche. Of what this consists we do not know and no hypothesis can be ruled out. My hunch is that if we could really comprehend death then we could understand the UFO. But that neither can be understood unless they are looked at in light of the question, what is humanness?

I believe that the transpersonal component of the human psyche is not distinct from matter and that therefore it can literally do anything. It is not subject to the will of any individual. It has a will and an understanding that is orders of magnitude more sophisticated than any one of the individuals who compose it as cells compose a body. It has a plan, glimpsed by individuals only as vision or religious hierophany. Nevertheless, the plan is unfolding. There will be many more UFO sightings, many more close contacts. Our belief systems are undergoing accelerated evolution via increased input from the other.

Somewhere ahead of us there is a critical barrier where we will at last have enough data to obtain an integrating insight into the riddle of humanity's relation to the UFO. I believe that as this happens the childhood of our species will pass away and when this is done we will be free to use the staggering understanding that humankind and the UFO are one.

It is the genius of human technobiology to master and to serve the energies of life and death and time and space. The UFO holds out the possibility of mind become object, a ship that can cross the universe in the time it takes to think about it. Because that is what the universe is--a thought. And when thought becomes mobile and objectified, then humanity--novices in the mastery of thought--will begin to set out.

Of course we may discover that we are not to set out; the future may reveal instead that there is something out there calling us home. Then it will be our technology and the call of the Other that will move toward meeting. The saucer is an excellent metaphor for this. When Jung suggested that the saucer was the human soul, he was more correct than he may have supposed. It is not so far away. That is the other thing. The last shift of epochs gave us relativity theory and quantum mechanics. Another epochal shift looms, but whether or not it is the final epoch is hard to say. Our roles as parts of the process introduces an uncertainty in our observations that bedevils prediction.

_TRUE HALLUCINATIONS_ Terence Mckenna

"IFO" by Hed

How does a flying disc turn into a weather balloon
How long did you think you could trick us with lies?
Can't put a cover on the skies
Can't hide that face or those big black eyes

Famous people who have had UFO sightings:
John Lennon of The Beatles - sighting over New York from his apartment
President Jimmy Carter - witnessed (along with about 20 others) while Governor of Georgia
Walter Cronkite - on a South Pacific Island in the 50's, he witnessed a supposed planned military experiment to test news media on new technology - he insists the UFO was not of this earth
Jimi Hendrix - witnessed a UFO while giving a concert in Maui on the lip of an extinct volcano
Muhammad Ali - "If you look into the sky in the early morning you see them playing tag between the stars."
David Bowie - "They came over so regularly we could time them. Sometimes they stood still, other times they moved so fast it was hard to keep a steady eye on them."

"In these they roamed the stars. They no longer built spaceships. They were spaceships.

"But the age of the Machine-entities swiftly passed. In their ceaseless experimenting, they had learned to store knowledge in the structure of space itself, and to preserve their thoughts for eternity in frozen lattices of light. They could become creatures of radiation, free at last from the tyranny of matter.

"Into pure energy, therefore, they presently transformed themselves, beyond the reach of time...They could rove at will among the stars, and sink like a subtle mist through the very interstices of space।"
-Arthur C. Clarke

for a look at the french bureau of aerospacial secret archives:

http://www.cnes-geipan.fr/geipan/

Pop Cosmos: The real thing

2007-03-28T12:07:00.000-07:00

Lately we’ve been witnessing drastic changes in our relation with the cosmos. French government has just announced that all its extraterrestrial secret files will be released for the public domain through their space agency’s web page. On the other side, various entrepreneurs, like Virgin’s Richard Branson or Amazon’s Jeff Bezos are betting on the possibility of having accessible (20,000 usd) tourist flights to space, and even galactic hotels, before 2017.

Preparing for this new cosmic scene, were we could reach never-seen levels on intimacy and interaction with our universe, a “Declaration for peaceful relations with extraterrestrial civilizations” was established last summer during the “Extraterrestrial Civilizations and World Peace Conference” in Hawaii:

Honor the following principles for establishing peaceful relations with extraterrestrial civilizations:

1. We affirm the intent of humanity to join in peaceful and cooperative relations with extraterrestrial civilizations,

2. Affirm support for United Nations resolutions promoting the peaceful use of Outer Space, and support for UN, International and U.S. Congressional initiatives to prevent an arms race in outer space, including the weaponization of space,

3. Affirm the natural right of all citizens to have open contact with representatives of extraterrestrial civilizations in all cases, and to engage in non-official diplomacy,

4. Declare the need for Civil Society to develop acceptable protocols (standards of behavior) with extraterrestrial civilizations, that the protocols should be representative of the aspirations of all humanity, and that all nations should work in concert to establish peaceful relations,

5. Cooperate with extraterrestrial civilizations in promoting Earth, Cosmic and Life friendly technologies, and encouraging the right use and open availability of these technologies,

6. Affirm our desire to coordinate the earth's ecological health and biological diversity with extraterrestrial civilizations that can aid us in that endeavour,

7. And express our desire to welcome the open appearance of benevolent extraterrestrial civilizations.

http://www.exopoliticsinstitute.org/Hawaii-Declaration.html

Are you ready?

White Spring Vortex

2007-03-22T18:31:00.000-07:00

PoHurricane Ivan (2004)

David Lynch: plays detective on 9/11

2007-03-22T12:00:00.001-07:00

Like his alter-ego, Dale Cooper, the Twin Peaks Sherlock, David Lynch follows some interesting and undelved leads on the 9/11 mystery. The master of ater-realities also shows some of his artwork on the subject.

Spring

2007-03-21T21:35:00.000-07:00

.
.
.
Sound the flute!
Now it's mute!
Bird's delight,
Day and night,
Nightingale,
In the dale,
Lark in sky,
Merrily,
Merrily merrily, to welcome in the year.

Little boy,
Full of joy;
Little girl,
Sweet and small;
Cock does crow,
So do you;
Merry voice,
Infant noise;
Merrily, merrily, to welcome in the year.

Little lamb,
Here I am;
Come and lick
My white neck;
Let me pull
Your soft wool;
Let me kiss
Your soft face;
Merrily, merrily, to welcome in the year।
.
.
W Blake

BROADCAST- PAPERCUTS

2007-03-13T14:48:00.001-07:00

dreammachine gyring and trancing softly nice girl singing jelly fractals in the blue back

Masaru Emoto in Mexico

2007-03-08T19:00:00.000-08:00

Some verbatim from Dr. Emoto's visit:

"we must learn the words water likes best, and use them to transform ourselves and the world around us".

Basically Masaru Emoto reminds us that we are liquid beings, and that water, our wombspring, is a molecule that is altered through thoughts and vibration, even words floating around. Which is a very interesting interface to consciously weave our realities or heal our bodies or the planet's.

Just flowing intention crystals

----------------------------------------- silver surfing secrets.

I understand his work as this possibility:

just picture the river through the rim
and it will appear in the mirror as you dream

flying frogs you can fly too! magnetic field balance levitation

2007-02-12T19:19:00.000-08:00

A number of experiments performed at the Nijmegen High Magnetic Field Laboratory have produced an amazing sight of fairy-tale resonance, flying frogs suspended in lab ether, canceling garavity in magnetic bliss. This is possible through the action of a magnetic field (around 16 Teslas are needed to lift flat a frog) upon a diamagnet, which is a substance that pulls away from a magnet, such as water (hence the frog's watery perefction), DNA, most organic compounds such as oil and plastic, and many metals such as mercury, gold and bismuth.

(not only frogs have been levitated, also waterdrops, grasshoppers hazelnuts etc., watch the action at:
http://www.hfml.ru.nl/levitation-movies.html

It is most interesting to tap into this magnetic realm of possibility, perhaps a frozen goldcoin in the sky or the snakeleap of your own genetic strands flashing like mercury in the red room of the body, floating between the cells in small eternity. I have the feeling old sages willed their magnetic fields (electromagnetic energy fuels the spin of the chakras), defying gravity in order to ride the cloud of epiphany.

......
A flying coffin
or a flying carpet
deliver in myth the true dreams
of our highest rivers.

remember what the rabbit said to the mirror
"... its the only way of life"

Pop Cosmos (stellarium social network)

2007-02-01T20:59:00.000-08:00

Visual contribution from our friend Mr.Hubble

Pleiades Star Cluster

Orion´s Cradle

The Coma Cluster of the Galaxies

Robert Anton Wilson

2007-01-28T21:09:00.000-08:00

18-01-1932 --- 11-01-2007

flying lasagna's crow,
bob womb bob lays calmly

raw

sputnik

2007-01-17T21:03:00.001-08:00

long interstellar womb silence

the Mirror talks on: dreamwakecontinuum

2006-12-07T17:20:00.000-08:00

look at his hand
while you dream

---------------------------------------------------------------------------------------------------------------

the interwoven highway of reality and imagination (blue sky ever and dark night endless)

it is the only road that doesn´t stop
(it is also the only place where the map is the territory, and the menu is the food)..
a pie a pi a spiral: phi

always away, always home...

"Everything leads us to believe that there exists a certain point of the mind at which life and death, the real and the imaginary, past and present, the communicable and the incommunicable, the high and the low, cease to be perceived as contradictions..." - André Breton

In Gadamer´s hermeneutics, it is referred as the "fusion of horizons".

Hermes (Thoth), in esoteric lore was the first oneironaut. he is sometimes depicted as a human ibis who joined the flight of a pack of wild birds over the Nile river, extracting from their moving geometry the building blocks of pictographic language, stealing from skybeings a secret fire of words: symbols. (a metha)
(also Percy Shelley "Prometheus Unbound")

(Sigmund Freud in 1900 published "The Interpretation of Dreams", a study in which dreams reflect deeply earthed symbols) akash taboooooooooooooooooooooooooooooooooooo oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo

"Looking at what people with shamanic traditions say about dreams, one comes to the realization that for those people dream reality is experientially a parallel continuum."
Terence Mckenna

"i dream of wires and railroadraves, i dream of rainbows and brains"

"like the lotus (like the lotus) that submerges in the night into the waves...
our innercore has its roots in that which is not phenomena anymore, but, on the contrary, begins to be the thing in itself, where all phenomenal forms fail... in this radical point of existence the multiplicity of beings ceases to exist".
Schopenhauer

"We are stuff as dreams are made off", Prospero "The Tempest".

IamchuangtzeIamthebutterflytattwamasinlackech

mosquito-bite-blue-changes my cells flicker-ing: hey hum phat thetawaves
jade

"The dreaming body is as real as anything we deal with in the world". (Castaneda, The Art of Dreaming

"If you don't have a form, you don't have to go to sleep to do dreaming . The eye in front of you pulls you every time you want to go". Carlos

Amorphous foam is fun:- Venus twilight dream (ask the evening)- eye in the sky- in palladium i melted like vanilla future icescapade - a strange attractor a beckoning scout ... from afar carpet cloud. cotton candy hug the soliquid rainbow nirvana-my-arms. andisappearing typoerror type of era tycoon aeon tycho brache looking at the stars and copernicus helio-hi...
(fusion is apossiblility, Nostalgia 77)

"je suis un autre" Arthur Rimbaud

"The self dreams the double. Once it has learned to dream the double, the self arrives at this weird crossroad and a moment comes when one realizes that it is the double who dreams the self. Your double is dreaming you. No one knows how it happens. We only know that it does happen. That's the mystery of us as luminous beings. You can awaken in either one." C.Cat-sign-jedhi

Brahma the suprapersonal being of Hindu divine memory is sometimes dreamed as an all-encompassing (a teddy bear and a wrathful grizzly) entity sleeping in pre-space, dreaming the worlds, the universe. and when he awakes the world ends or begins again. we are but a speck of dust in his eyelashes while he r.e.m.'s

Brahma, like Brazilian cars sighs (Senna),(millerdrive) he is the atman (soul of songs); inhale now the spirit you r.e.m. extramember- return to the source - in autumn gold-gopher . O.B.E.SOMA

"If they (dreamers) can't see the energy of an item, they are in an ordinary dream and not in a real world.  What is a real world? A world that generates energy; the opposite of a phantom world of projections, where nothing generates energy, like most of our dreams, where nothing has an energetic effect". Don Carlos

"From it to q-bit" John Wheeler

"Do lucid androids dream of electric sheep that appear at will"? Phillip K. Dick

"Dreaming entails cultivating a peculiar control over one's dreams to the extent that the experiences undergone in them and those lived in one's waking hours acquire the same pragmatic valence. The sorcerers' allegation is that under the impact of dreaming the ordinary criteria to differentiate a dream from reality becomes inoperative". Datura Crow

"All life is only a set of pictures in the brain, among which there is no difference betwixt those born of real things and those born of inward dreamings, and no cause to value the one above the other." H.P. Lovecraft

"If a little dreaming is dangerous, the cure for it is not to dream less but to dream more, to dream all the time". Marcel Proust

"we must dream with open eyes, dream with our hands,
dream active dreams of rivers sourcing paths, dreamsuns
dreaming their worlds, dream loud: birds, boughs, stars..."
Octavio Paz

Swivelling doors, humming birds, eyes that hypnotize like snakes, yourhands: a gyring spiral (el caracol y la galaxia), a rainbow lollipop or a sufi girl; a windmill like Don Quijiote, a whirling tapdance like Don Juan or Salome with your head, all of these images -engines of dream, cues and gates and secret winks- are a seduction, like the loafs of bread in the forest, like any whisper or someone in the bushes (breast-a-flame) seduction to recall, seduction of an entrance. Images to rove on.

"The dream is eschatological. The dream is zero time and outside of history. We wish to escape into the dream". Terence Mckenna

"No doubt, when DREAMING one can pretty easily leave one's own metagalaxy. We need just to drop down a Black Hole. Thus any Terran's body of DREAMING can overcome the three-dimensional space of our universe and turn out itself to be in another (parallel) world" DR.Noviko Moscow State University

"One's particular life situation can be molded to fit one's specifications. Dreamers do that. A wild statement? Not really, if you consider how little we know about ourselves. (Delphicarlos)

"Dreaming is as serious as seeing or dying or any other thing in this awesome, mysterious world. Think of it as something entertaining and don't get discouraged or stop trying if you don't succeed right away. Imagine all the inconceivable things you could accomplish".

* * *

Trying tu surf the dreamwake-wave it is recommended to distort at whim the faces of your guests (Mom you are a ghost, Please stay!), to draw doors on air, to engage in revealing conversations with invisible (only at times) creatures (talking to a transfinite hypercube serves) to force borderline situations, shock-school therapy (in the way of ancient kings: burn your house, eat your cat, laugh, have sex with the upharaoh´s sister) extra-limiting always, and to create implausible systems of belief, disciplined to a Hegel-like philosophical stronghold: for example the history of thought (i.e. philosophy) in our species is the gradual unfolding of consciousness in man through its symbiosis with quartz crystals and dolphins thus dawning in the synthesis of the Absolut Spirit, the self-conscientious Quartz in the Sky of the Mind that fills the World with Light, avatar of the Monad Fractal of History, mirroring, in the angelic language (semiosis) of dolphins, the crown of reason and, in its potentia, the State as emergence and seal of evolution sub-species aeternitas of which im Wholly and Infallible King.

The result shall be a flowing undifferentiated reality scheme where things look more like maya and shake and photoshop and arcade than Victorian England or white picket fences or you haven't changed a bit - continuously in this wake-.

"And when he awoke from his dream, he still had the white poppy flower he had received in heaven". Samuel Taylor Cooleridige

"Believing that our energetic conditioning is correctable, sorcerers of ancient times developed a set of practices designed to recondition our energetic capabilities to perceive. They called this set of practices the art of dreaming . It's the gateway to infinity". Don Juan

andtheedreams:

Dreamers speak of entangled dreamscapes, an island where people return to or a hotel where they leave marks and you go and see a picture in the wall that wasn't there 5 minutes ago or two dreams before and that you might recognize "well this looks like Solanges handwritting, yes it figures, its in french and she doesn´t dot her i´s." And you may wander off into the champagne-chrysalis local waterfalls and find your friend bathing and ask "well aren´t you in Vienna, now".
Sucha place we have known, certrainly there are more, but this one is called
Boohbah, it is a magical place of oniridiscence, our own private Shangri-la, you might run into it in your dreampath.

"Then something else attracted my attention: a sun at the very zenith of the yellow sky, right over my head, a mild sun -judging by the fact that i could stare into it- that cast a soothing, uniform whitish light.

Before i had time to ponder upon all these unearthly sight, I was violently shaken; my head jerked and bobbed back and forth. I felt i was being lifted. I heard a shrill voice and giggling and i was confronted by a most astounding sight: a giant barefoot female". Castaneda, Tales of Power

"In my dream i was in a parade, a syncrethic parade perhaps in spaceage china, but they still had all of their laureate torture engines- not short, either, on masks of dragons and tao-monsters, garudas and alien birds, not short, either, (escherballs) on their array of firelights blazing in the sky and a-thousand laughs surround. I was to be catapulted, in a circus-like demonstration of olden trickery, Manball, rubbersoul jettisoned, they strapped me to this land-bungee that was also the tongue of chaos. Fucking everybody cracking-up, priests with beards everlong like whiterivers feathered and the countdown clown clock bursting, yelling protruding "Go Go" so they blew me out into the sky and off the slingshot. I was terrified, naked, feeling compressed gravity like a wall, like an impregnable womb tunneling chemosphere. But suddenly all the friction resolved in that fake-plasma-picture of blue space and i was thru. High in the air, rocketing with my body and surpassing spheres of strata. I realized i was dreaming. I realized those people in the ground where my kin, wind-rare brethren, other lives that still live in a recording, an unfathomable disk of memory that coexists overlapping other disks dancing mixed perfectly by a mammoth dj that spins endless turntables. Awaking walking in the air and the thought, in a silver voice: YOU CAN DO ANYTHING ITS A DREAM you are master-home-theater. But still forces acting, energy factors sweeping. I felt a vertical magnetism summon my cells, sky-pervading, i looked up and saw a solar vortex, a cluster twirling like a nuke-head of vanilla in full-steam or a sort of Tesla reactor with velvet yellow Light, very mellow for my body´s plexus which instantly keyed into pleasure and sped at what might have been the touch of the speed of Light, weightless and immense leavin off the azure carcass, penetrating fully the giant orchid flower, calling, membranous, and inside... an inside that is made of the stuff stars are made off, the stuff dreams are made off." http://dreamgate.com/electric-dreams/ (dreamnews monthly)

dreamawakingdream

river on friend: Stephen La Berge

2006-11-20T11:43:00.000-08:00

Master of dreamscience.

He has taught lessons on altered states and psychobiology in Stanford University, the same school were he previously got a Ph.D. in Psychophysiology.

In 1987, he founded The Lucidity Institute which promotes research on topics related to lucid dreaming.

“Lucid Dreaming: The Power of being aware and awake in your dreams ”

“Exploring the World of Lucid Dreaming” with Howard Rheingold.

"Conscious Mind, Sleeping Brain"

LaBerge designed a device that facilitates the access to lucid dream states. It consists on a special kind of mask, that every time it detects that the user is entering into an REM cycle, sends flashlights directly to his eyes. The idea is that our brain, although asleep, receives a luminous signal that lets us know whenever we start a dream phase. This way you can consciously recognize your dreaming state and control your activities during it. The device is known as DreamLight.

Through the profound and rigorous study of oneirology, LaBerge has come to conclusions that go beyond the traditional perspective of science. He is recognized for being the first scientist to prove the phenomena of lucid dreaming, following an empirical method and being properly demonstrated.

“The basic idea of proving lucid dreaming was a simple one. It was based on earlier studies that showed that, if a person in their dream happened to be watching a ping-pong game and they’re looking from left to right, the eyes of their sleeping body would show a corresponding pattern of eye-movement activity. So I had thought that, since in a lucid dream I can volitionally do whatever I want, why not make a signal that we could agree upon in advance; a pattern of eye-movement signals that could then be used to prove that I had a lucid dream and that I knew I was dreaming while I was in the dream? We could also use that to establish what stage of sleep lucid dreaming occurred. I thought it would be REM sleep just because that was when most dreaming occurs.”

His work invites us to take a conscious responsibility for our dreams, transforming ourselves in a rational reflection of Chuang Tzu´s butterfly.

“The most important kind of sleep-learning that you can do is not having a tape-recording and trying to pipe more factual information into you. Sleep time is not a very good time for taking in information, but lucid dreams are an excellent opportunity for experiential learning, for finding out about the wisdom of life. Having an encounter with a dragon, for example, which you won’t ever have the opportunity for in the waking state. You have to have the courage to resist the fear that you’ll actually feel, to say this dragon is a mental image - a mental image can’t hurt me, and then to act on that. I would advise having a conversation, making friends with the dragon. The point is, is that what you can learn from your experiences in the lucid dream state are things that can apply to your waking state.”

The Lucidity Institute --- http://www.lucidity.com/

Awake the mirror:

enjoy the parade --- invoke lucid highways for all our dreams…

river on deity: Arianrhod

2006-11-19T18:59:00.000-08:00

Arianrhod “The Silver Circle”

.
.
.
Known also as “High Fruitful Mother", she is one of Britain’s three virgins.

Celt goddess of the moon, fertility, reincarnation and seasons. Her divine nature is related to the art of weaving and regeneration.

Mother of Dylan Eil Ton, the “son of the wave”.

She guards the silvered wheel of stars which represents time and karma. Through her, you can contact the Star People and also the portal to past-life memories.

She is a deeply sexual goddess. If you copulate with Arianrhod, you’ll sure feel the mirror’s surface. A foot over her lap ensures you a path to a vivid connection with the feminine planetary axiom. Her festival is celebrated on the second of December.

Related with the element of fire, she controls the time dimension. Her image and the principles of the archetype her figure represents, seem somehow forgotten in the perception of occidental culture.

Her palace, Caer Arianrhod, is located on the Corona Borealis.

Like a silvered feminine mandala, she guides you through the sacred highway that leads into the balance of unity.

“The traveler must follow the Spirit of Arianrhod with an open heart and mind.”
. .
. .

Cary Grant: Liquid.Silver.Delightful.

2006-11-19T18:52:00.000-08:00

Cary Grant, a holographic projection created by Archibald Leach. Born in Bristol, England, in 1904; died in 1986 in Davenport, Iowa.

Cary Grant, actor of popular motion pictures such as The Philadelphia Story, North by Northwest, Catch a Thief, Notorious, Bringing up Baby, Monkey Business

Grant was a favorite of such directors as Howard Hawks and Albert Hitchcok.

He acted alongside helluva-soft-filmlight-stars as the swedesilver Ingrid Bergman, Grace Kelly, Mae West, Marylin Monroe, Katherine Hepburn, Sophia Loren etc.

A bonafide Hollywood icon, perhaps unmatched in charm and elegance. The Rolls-Royce of leading men, always nonchalant and sophisticated, the dreamchevalier of the starsystem.

An executive for luxury firms such as Faberge, Grant traveled the world for the company of the jeweled cosmic eggs.

One of the first sponsors of L.S.D (Lysergic Acid Diethylamide), Grant took acid in the late 50's for therapeutic reasons under Dr. Oscar Janiger. This experiences changed his life helping him overcome his ego (fledging from babe-magnet into mandala-personality) and his fears of insecurity and lovelessness.

I underwent a series of controlled experiments with Lysergic Acid, a hallucinogenic chemical or drug known as LSD 25
(over 60 of them, it seems Grant basked on the candy magic)

The action of the chemical releases the subconscious so that it becomes apparent to yourself. So that you can see what transpires in the depth of you mind — and what goes on there you wouldn’t believe, ladies and gentlemen — and learn which misconceptions, guilts and fears, with their resultant repressions, inhibitions and insecurities, have formed the pattern for your past behavior. A successively recurring pattern since childhood.

Curiously Grant seems to have been responsible for luring Timothy Leary into drugs (and also Jack Nicholson), the (subtle) energy of attraction Grant-Leach possessed was enthralling.

The joke of all this is that, in a sense, Cary Grant got me into psychedelic experiences .* I was a psychologist, from Harvard, when I heard about Cary Grant getting into [LSD]. That struck   me very much; that attracted my attention. I had been very much against the use of drugs  before that; Cary Changed my Views. He converted me.  *It was generally claimed that the reverse was true. (DR.TIMOTHY LEARY)

He was always charming, professional, courteous, open and helpful. I   remember he said, referring to his Universal cottage, "What do you think of this bungalow?   Would it be a good place to have LSD?" I replied, "Well, I always like to have a fireplace   [during the experience]." He said, "Well, I'm going to call the studio right now and have them   put a fireplace in." That was typical of him. (Timothy Leary)

--------------------------------------------------------------------------------------------------------------

A strange liquid mirror looks at us from time past -those bizarre sessions in the "cottage", those dreamscapes into wild Mexico, those joint ventures and oceanic orgies in which Leary, Huxley, Cary Grant, Anais Nin, and others took the pill of communion and tranced into the mystery, that and the toast and the tea, the refinements, the small talk, the modulations of the moments that breach open the history of unequaled mystic haughtiness.

riveron questions-reality tunnels

2006-11-18T14:56:00.000-08:00

do you believe in reality?
and if reality doesn't exist or its just an evanescent opinion
why does it hurt so or why does it generally appear to be the same
solid box?
do you believe in the everlasting laws of physics?
do you think that a mouse looking at the moon transforms the moon?

*****************************************************************
and most importantly:
are your dreams able to create the reality you want to live in?

now i dream of an orange sephirot of energy
now i deam of a glowing tree growing in the sea
now i dream of oceanic feelings and mermaids
i believe in unicorns and holograms
(but i could believe in anything else)

can u see that something is happening, which is not happening at all?

riveron friend: Robert Anton Wilson

2006-11-14T18:05:00.000-08:00

Robert Anton Wilson one of the mavericksofthemind in cultural stream chaos now, author of many books and reality tunnels, a main exponent of shining-hiena disappearing-art, firefox deamon etc. is suffering from post-polyo syndrome in addition to economical mishaps. Not that RAW doesn´t know his way around, but we still make audible our support through spiral kiwaves and energy logo(lotus)flux. As of now the reports state that RAW is reaping his own reefers to fight-off the pain and drifting with the idea of a complete abolition of such a contractive turn-off.

RAW is author of such great mind-enhancement, belief-system-breaking books as "The Cosmic Trigger" or "The Iluminati Trilogy"etc.

Bob is also chairman of the Discordian Society, an autonomous organization created in disorder to serve goddess Eris and to surf and stray the chaos angel engine.

Steal candy from steel-chalice-people (77)

RAW holds the post of American director of the Committee for Surrealist Investigation of Claims of the Normal (CSICON)

RAW considers himself a mystic agnostic.

"Father of Conspiracy Theory".

Here is a random collezione of Robert Anton Wilson's quotes. Later we will enter a full profile of one of the most influential trickster thinkers of our time. Notice lasergyc humor all-through. (What strikes brightest in Anton Wilson is how laughter cracks the walls of the mean-machine, leaks a door maybe (like piss is thunderlight in the sky), in white hole hope: the crannie-flower, where the flashing teeth in the old dragon's s.m.i.l.e. ( space migration, intelligence increase, life extension) space the loopholes needed for passage (guardian dazed)
into the garden gem:

Reality is what you can get away with.

Information is the source of all wealth.

Beyond a certain point, the whole universe becomes a continuous process of initiation.

The longer one is alone, the easier it is to hear the song of the earth.

A perfect master is ideal, but only if you want to be a perfect slave.

I used to be an atheist, until I realized I had nothing to shout during blowjobs. "Oh Random Chance! Oh Random Chance!" just doesn't cut it….

All I can say about my years at Playboy is that those were the happiest years of my corporate existence.

Most people just take themselves too damn seriously, which is why they act like damn fools.
Since gene-pools last much, much longer than biological units, or persons, I assume gene-pools have higher intelligence than the isolated units. Since species last longer than their sub-divided gene-pools, I assume that a species has a higher intelligence than any gene-pool within it. And since Gaia or the Big Computer or whatever you want to call the total Terran Geo-bio-mass has lasted billions of years --despite floods and earthquakes and meteors and massive extinctions and Ice Ages -- I assume it has more smarts than any sub-sets like kingdoms, families, genera, gene-pools, etc.

The Great Pirates in modern times make up a group the abbreviates "MMAO": Machiavelli, Mafia, atoms, and oil. It's the international banks, the Mafia, and the atomic and oil cartels. He doesn't claim they work together, but they more or less make a singular force. But he also says that they're so engaged in conflicts with one another that they're steering Spaceship Earth in 50 different directions, which is why we're going around and we're not getting anywhere. I tend to find that fairly credible.

My hunch is that consciousness is a non-local function of the universe as a whole, and our brains are only local transceivers. As a matter of fact, it's a very strong hunch, but I'm not going to dogmatize about it.

rawilson.com

11:11

2006-11-11T21:05:00.000-08:00

1 a mirror of the mind digitalized as time1
1 -a door confirming glow-consciousness- 1
1 -the lion-pulse of the sun's cycling rain- 1
1 the numbre of magic (biunity: Crowley) 1

theairisawhiterainbow

2006-11-08T17:48:00.000-08:00

Uno de los axiomas del Kybalión, libro del pulso o de la escuela de Hermes,
dice "el universo es vibración".

El concepto de la vibración (o el de frecuencia) se viene manejando (popularmente) desde la revolución psicodélica de los 60´s; pero casi siempre sólo como una intuición o como sucedáneo de nuestras limitaciones linguísticas, al no poder precisar algo esto se generaliza en el enjambre nebular de la vibra. Sin embargo, ésta incipiente alerta a las modulaciones del ambiente, a los aludes de ondas electromagnéticas, azoga una resonancia profunda con la naturaleza del universo y la construcción de la realidad a través de la percepción.

Esta es la teoría de La Naturaleza Poliarmónica de la Realidad

"El paneta Tierra es un organsmo electromagnético que exhibe una resonancia periódica (generalmente se conoce como la resonancia Schumman 7.8 hertz por segundo), una frecuencia natural de vibración sintonizada por el momento angular de su rotación axial. Ionizada por un constante influjo de radiación solar, el patrón de onda habitual propagado por el dominio de frecuencia fundamental de la tierra es amplificado y aumentado en un complejo patrón de ondas que se entretejen e interpenetran pero sin superponerse e interferir( en la gran mayoría de los casos), pues si esto ocurriera percibiríamos el mundo como una confusa y caótica borrasca (algo como un holograma divido hasta perder su imagen).

Realmente no existe el color, el aroma o el sonido en la naturaleza- sólo hay una matriz de energía que se desdobla en materia en un flujo (holomovimiento) eterno. Y este flujo es una red poliarmónica de longitudes de onda que se entretejen- las cuales cuando son transducidas por la neurobiología humana se convierten en el mundo fenoménico cuya reproducción reconocemos como la realidad o la vigilia.

Pero la neurobiología humana es ya de suyo un organismo electromagnético sintonizdo y restringido a un dominio específico de frecuencia dentro de la Hiperesfera-Mundo. Cualquier longitud de onda que se propaga más allá del dominio de frecuencia específico en el cual opera comunmente la neurobiología humana se filtra inaccesible- se vuelve invisible, imperceptible, inexistente. SIn embargo sería un error suponer que (lo invisible) no existe sólo porque no entra en el espectro limitado de nuestra perecpción.

Si aceleramos el momento angular de los electrones que componen el neurosistema humano la la frecuencia fundamental del cuerpo se eleva, produciendo sobretonos armónicos más altos, d esta forma expandiendo la conciencia a estratos de perecepción más sutiles dentro de la Hiperesfera".

http://www.futurehi.net/archives/000823.html

Dia de los muertos

2006-11-06T07:47:00.000-08:00

Before and After Science: Electric Sheep

2006-11-06T07:46:00.000-08:00

So what do you think your computer does while asleep?
::::: she dreams...
And what do you think your computers do while asleep and being connected to the www?
::::: they share a collective dream were digital unconscious information is holotransmited between them.

Have you joined the fractal electric-sheep community?

This is a project that creates a fractalsharing net. Each fractal is designed by a different person-computer, and it represents its own electric-sheep, its own dream. While the computers are netdreaming, they weave an interchange of fractaldreamsheeps. This initiative is inspired in Philip K. Dick´s book "Do Androids Dream of Electric Sheep".

For further information or joining the electric sheep, visit http://electricsheep.org/

Working the Out of Bounds: Dreamachine

2006-11-06T07:45:00.000-08:00

invented by Brion Gysin
(top five on the William Burrough´s coolest guys list)

do you want one?
you are one

build it
and you will come
into the mindfields of light
sufiwaves
invisible landscapes
and very laid back selftransforming
chill pill of flowers and fractals
so perhaps today try
and smoke some light
eyecandy becomes
mind samadhi

The dreamachine works as a sort of electronic mirror that reproduces synergetic waves and patterns of light mimicking deep brainfrequencies, particulary alphawaves ranging between 7.5 and 13 flashes per second.

This hypnotic rate of light emission induces the psychonaut -who remains tete-a-tete with the machine- to a hypnagogic swoon of polychromatic reverie -de-lightfully producing innerpatterns of sacred geometry that slowly attune him into deep meditative trance. And thereon it is the dreamer, the tripper who scales on his own the unfathomable axis mundi ladder of his mind and finds the deepest jewels of consciousness or just relaxes and hangs out in a cool place of waves and forms. But the door through the mirror-machine is there -as always it depends on you and how deep down the rabbit-hole u want it to glow?

-------------------

Mr.Gison claims to have thought-out the dreamchine when -in classic newtonian-like epihany- he was riding a train through the country , looking through the window into the trees as he happily dozed off. But he noticed, with eyes wide shut, that the leaves of the superseding trees where slicing up the sunrays and forming pattern inside his mind. This patterns, at a synchronic speed, in a relaxed state of mind, drifted him into a lucid dream. Thus the technology, imitating nature was born.

and the leaves cut the glass
the sun the eyes, the brain is outside
as the passenger slips by
a gentle woods god has a beautiful knife
master of his craft
this class he will show u
how to dream
with your hands

*************************

Building a dreamachine is easier than building a bomb, and as usual all you need is provided in a near hardware store.
The blueprint, easy to employ is available in the internet.
It is cheap and cosmic fun.

**************************

extra extra extra!
polysester doll gone crazy with dreamachine (New York Times)
extra extra extra!
extrabody experience
Mr.Rober Anton Wilson Chairman of Tha Dyscordian Society
Illuminati of Chaos, Reports
Using the Pulstar Light and Sound Device
I had a an outerbody experience, astralflight contemplating myself ecstatically near a monolithic machine, wearing sunglasses for the midnight sun, laughing out my soul.

Can you do better than him?

******************************

just surf the light

the river sounds on: FSOL

2006-11-05T20:25:00.001-08:00

This is the Future Sound of London

Electronic music project, created on a probably foggy day, in Manchester, UK, around mid eighties, by a couple of friends: Brian Dougans and Garry Cobain.

Along the history of the band, the duo has maintained a really discrete and mysterious way of handling the media and their audience.

Although they’re usually labeled as ambient, their music has denied every attempt on inserting them into a specific genre. They surf from unique ambient manifestations through tribal rhythms, spiritual atmospheres, ludic evolution and psychedelic sonoric expansion. Along their carrier Dougans and Cobain have shown different lines of deep exploration, resulting in a colorful cocktail of sounds and moods. Their search has included different areas, including 2D and 3D computer animations, experimental radio broadcast, video and film.

Famous for their finesse in remixing and samplings, this duo has remixed works of Robert Fripp, Curve and David Sylvian.

Amorphous Androgynous, Art Science Technology, Humanoid, Intelligent Communication, Mental Cube, Q, Semi real, Yupie and Yage, are only some of their aliases.

“People are gradually realizing, ‘Actually I’ll make less money, take more risks, have more faith, sell my house, move out of London, work for different people, find different people, then discover ‘My God, life’s a trip, My God, life’s exciting, My God how did I ever accept the prison walls.’ That’s what it’s all about. I don’t need massive amounts of money, to be honest; I live very simply. At those points when people threaten my freedom of expression, I just say goodbye and go with people that love what I do. Personal truth will not harm me in the long run.”

In the last years, this bright couple of sonic explorers has shown a deep attraction towards Psychedelia, a stronger presence of organic and ethnic elements characterizes their latest work.

"Psychedelia is about escaping from our adult cells and getting back to a childlike perspective on life, possibility, joy, fun...celebration, really. I think there was a period when electronic music was really a way out, it was [about] breaking lots of rules, and then it's just became a set of rules..."

These are some of FSOL’s most significant works:

Stakker '92 (as Humanoid) (1992)
Accelerator (1992)
Earthbeat (early releases using several aliases) (1992)
Tales of Ephidrina (as Amorphous Androgynous) (1993)
Cascade (1993)
The Far-Out Son of Lung and the Ramblings of a Madman (1994)
Lifeforms (feat. Elizabeth Fraser) (1994)
Dead Cities (1996)
Papua New Guinea (2001)
The Isness (as Amorphous Androgynous) (2002)
Alice In Ultraland (as Amorphous Androgynous) (2005)

“Life and every aspect of it is even more amazing, the more aware you are; to breathe and fuck, whatever you want consciously becomes the most amazing thing.”

Because of their “one step ahead” musical philosophy and their sensitive codification sampling, pointed towards the creation of mystical sonic paths, the river sounds on the Future Sound of London.

river on friend: Terence Mckenna

2006-11-05T20:23:00.000-08:00

,

"Pay attention. And keep breathing". Terence Mckenna on the possibility of having a bad trip.

Terence Mckenna(1946-2000), psychedelic superstar (star of the underground, like the blazing fractal rhizomatic corals doormant in the archaic mind) “the real Tim Leary”, (Terence doesn't smell like candy C.I.A.) a postmodern technoshaman and cultural bricoleur who delivered a message full of heart and epiphanic iridiscence.

Terence inherited a scientific, naturalistic mind, approaching reality as one that explores his housegarden, and later the nearby forest and later the Amazon or the Himalayan mountain reef, and way through into his neurocortex-weaved-with-the-galaxy and all the books and memes and crystals -a holofloral internet, reavelling an informatrix of Logoflowing spirit speaking softly like the voice in the digital wildreness.

“I have always been extraordinarily obsessive about a certain kind of iridescence, a certain quality that can haunt matter, or people, or a painting. My first obsession was minerals. I went from minerals to butterflys, and from butterflys to science fiction, which I definitely consider a psychedelic drug because it empowers the imagination”.

After graduating from Ecology and Conservation, at U.C Berkely, Terence travelled to Asia smuggling dope and collecting butterflys for biological supply companies. He once was wanted by the Interpol.

His first expererience with psychedelic plants was his ingestion of commercial morning-glory seeds, the virgin-climber-flower, the epitomy of the Gaian-Xochipilli devoted plant.

Mckenna developed a theory for evolutionary polypharmonics, where psychedelic plants are central in the unraveling of a Green Consciousness, Veriditas, the plant-plan for the planet, in this way sweetly entering the Gaian Mind or Noosphere and forming a symbiotic synergical synesthetical realtionship with Earth and Eschaton. Like riding the timewaves in a vegetable philosophical stoneboard.

Terence studied and experimented profoundly with the nature of psychedelics, specially with tryptamine molecules, such as the ones in psylocibn mushrooms, ayahuasca, d.m.t. and the brain itself. And what he found was awe-inspiring and skybreaking. This plants, this spirits, shared a powerful morphic field of resonance that enabled access to archetypical transdimensional information. Blurring frontiers between mind and matter and man and stars and starbeings.

“The planet has a kind of intelligence, it can actually open a channel of communication with an individual human being. The message that nature sends is, transform your language through a synergy between electronic culture and the psychedelic imagination, a synergy between dance and idea, a synergy between understanding and intuition, and dissolve the boundaries that your culture has sanctioned between you, to become part of this Gaian supermind”.

Wholly intriguing is his intuition of this metahistorical relationship between plants and humans. Mckenna played with the idea that our evolutionary path is thorougly linked with the physical technology that plants embed on us. “On the Mushroom-dotted plains of Africa where the Great Horned Goddess...”, monkeys wading from trees might have eaten psylocibe mushrooms, triggering their language skills:

“The psilocybin -- which in small doses provides an increased visual acuity, in slightly larger doses a physical sexual arousal and in still larger doses full-on ecstatic hallucinations and glossolalia -- gave evolutionary advantages including the rearing of off-spring to reproductive age amongst those tribes who partook of it. The changes caused by the introduction of this drug to the primate diet were many—McKenna theorizes, for instance, that synesthesia (the blurring of boundaries between the senses) caused by psilocybin led to the development of spoken language: the ability to form pictures in another person's mind through the use of vocal sounds”.

Terenece, who among many things, was a voratious reader and herme-naut of Joyce’s Wake, in his entheogenic trances repeteadly had the vision of the Word incarnating into material form ("from heard to beheld") a glittering glossolallic hyperobject that trascends ordinary communication into the visible seal of truth, in his multisampled d.m.t voyage:

”And so like jewelled self dribbling basketballs these (machine self-transforming elves) things come running forward and what they are doing with this visible language that they create is they are making gifts! They are making gifts for you and they will say amuwi takwiti wati fatiunaabyumonya phama woaniaum …”

For, like the Kabbalist:

"The real secret of magic is that the world is made of words. And that if you know the words that the world is made of, you can make of it whatever you wish. "  or “the if the world is code, then we can hack it”.

And even more, Terence believed that the man-plant relationship was the key for a safe passage into hyperspace, in this trialing times of ecocide and cultural bestrangement. Enabling us to recapture the q-bits of the broken fractal map, and propulsing us with a vegtable star-ship (greendream bardo-thodol gimmicks) into evolutionary final exam.

"What is happening to our world is ingression of novelty toward what Whitehead called "concrescence," a tightening gyre. Everything is flowing together. The "autopoetic lapis," the alchemical stone at the end of time, coalesces when everything flows together. When the laws of physics are obviated, the universe disappears, and what is left is the tightly bound plenum, the monad, able to express itself for itself, rather than only able to cast a shadow into physis as its reflection. I come very close here to classical millenarian and apocalyptic thought in my view of the rate at which change is accelerating. From the way the gyre is tightening, I predict that concrescence will occur soon - around 2012 A.D. It will be the entry of our species into hyperspace, but it will appear to be the end of physical laws accompanied by the release of the mind into the imagination".

2012 is the endate of the Mayan Calendar Cosmogenesis , but this date was independently attained by Mckenna since the early seventies, through trance pattern-analysis, whatever that might mean.

Terence made a living from writing and giving conferences. He entered the “black hole” in Hawaii, by his ethnobotanical reservoir, in the year 2000, just short of seeing the end of the world as we know it. He was a master of channeling the waves of words and sharing them with a crowd eager to explore the mystery and the mystics of building a spacecraft through the concrescence of ideas and experiences harvesting in the body. Terence even accomodated a strange spore from outer space

The mushroom speaks:

“I am old, fifty times older than thought in your species, and I came from the stars… I seek intercourse with your species”.

Terence made it again intelligent and exciting to reach into plants and nature and take their teachings back into our technoscapes, bright priceless connections that one can never forget.

"We are like coral animals embedded in a technological reef of extruded psychic objects. All our tool making implies our belief in an ultimate tool. That tool is the flying saucer, or the soul, exteriorized in three-dimensional space. The body can become an internalized holographic object embedded in a solid-state, hyperdimensional matrix that is eternal, so that we each wander through a true Elysium".

"I speak of the technology of building a starship, I imagine it will be done with voltages far below the voltage of a common flashlight battery. This is, after all, where the most interesting phenomena go on in nature. Thought is that kind of phenomenon; metabolism is that kind of phenomenon".

"My vision of the final human future is an effort to exteriorize the soul and internalize the body, so that the exterior soul will exist as a superconducting lens of translinguistic matter generated out of the body of each of us at a critical juncture at our psychedelic bar mitzvah".

"History is the dash over ten to fifteen thousand years from nomadism to flying saucer, hopefully without ripping the envelope of the planet so badly that the birth is aborted and fails, and we remain brutish prisoners of matter".

"It may instead be what I've recently come to suspect - that the human soul is so alienated from us in our present culture that we treat it as an extraterrestrial. To us the most alien thing in the cosmos is the human soul.

" It is no great accomplishment to hear a voice in the head. The accomplishment is to make sure it is telling the truth, because the demons are of many kinds: "Some are made of ions, some of mind; the ones of ketamine, you'll find, stutter often and are blind.

"The Hubble Telescope is inside us".

"The three evils are: Monotony, Monogamy and Hegemony".

"Consciousness expansion in human beings is going to become an absolute necessity because we are summoning out of the woodwork of cybernetic technology machines that are going to require super-intelligent humans to direct and have discourse with them"

"Its just me, my mind, and Mother Nature".

"Hipparchus, in the second century BC, was asked what he feared most about death, and he said, Not being able to follow the latest discoveries in astronomy. Well, that's precisely my position".

"The best answer I've gotten yet out of this is from Don Delillo's Underworld, where the nun discovers that when you die you become your website".

Terence's prescrptions are crazy enough that they might work...
 Among his most significant works are:

"The Magic Mushroom Growers Guide"
"The Invisible Landscape"
"Timewave Zero"
"The Food of the Gods"
"True Hallucinations"
"Trialogues": Terence Mckenna, Ralph Abraham and Rupert Sheldrake
"The Archaic Revival"

His words have been put to music by such performers as:

Spacetime Continuum
The Future Sound of London
Zuvuya
Eat Static
Shpongle, and many more psychedelic trance bands.

For showing a new path in digital allchemy, a path of quantum organic revival -forwardback into the vibrant origi-, and keeping alive the ethereal flaming equation between Logos and surf, for being a warrior of the nightfence, for having fun at the most intense moment of disembodiment and becoming a pure wave of silver information. Terence Mckenna is a psychedelic river friend.

mirror cut river (a permutation in the method of Brion Gysin)

2006-11-05T20:20:00.000-08:00

"words don't belong to anyone
they'd rather spin and turn into things"
Brion Gysin

Atom river on mirror - RSS IFRAME: http:
avbar.g?blogID=41439 70579820555098 skip
to main skie to side barriver on mirrorSaturday, ,,
ºfaster than light) s at more than one place at the same timorr a same particle i
knity of wiresweaving together rigorous epistthe spirit of present
fractal intuition holoundoubtedly the floforward
flaming equation
graphic paradigm, a
intercointo
shift a path of quantum orgaowing a new path in provides an increased visuallocybin
back into the vibrant origi Future Sound of London Zuvuya Eat Spacetime Continuum
the soul and i
a superconducting lens of translinguist soul starship, I iium" ll our too technological reef
belief in an ultimate tool you wihat the world is mad
world is code, then we can hack it". Ansh. mirachrysalis holodeck And tock to feel The mult
tusun. .... And back there where it (sh,he a-thousandfold lo
ver eyes where undivided from rivers Sun sh)star-ted bear Why
moons women and layers of smiles fromakash girls divi
ing like the wheels of rollerskates In s and galaxies Revolv
bow quetzalcoatl fields- .Gison claims to have thought-out the dr----------------- Mr
hypnagogic swoon of polychrom-a-tete
he was rideamchine when -in the country sh
leep and being connected to the www? :::om-puters do while as
inactive dream were digital unconscious trees might have eaten psy Goddess
mystery us" of this superquantum interlocking aleccess the rise and fall of worlds boillball of a molecule
are already part of the waves of light ing in a puddle... U
ogram, make up the hol o u
codification samplingmusical philosophy
sonic paths, the river sounds on the Fut to create mystical
Humanoid, Intelligent Communicatis, Art Science Techn
Semi real, Yupie and Yage, are only someon, Mental Cube, Q,
People are gradually realizing, gettinsychedelia is about a perspective on life,
electricuter netdreaming selftransforflowers sundscapes and very leafiwaves invisible
mimachine works as a s rror that reproduces patterns of light who teteinduces the psychona
-a-tete with the macc swoon of polychromhine Do Androids DreamPhilip K. Dick
0 talk to the in a bong? ...Bill is cheap and cosmextra! polysister doic fun
electrocomplete and instant To music in othe
so Where diamonds flee summer holographicow -halcyon Rimbaud
Suneris eyes where undiv hopefurthe envelope of the lily without ripping
planet so badly
sounds applesilverds psyche-delicate orchdrfit us into amber sopholphins Oriblooming
Pleiades dippingkiri so high could me koolaid light morphic fieldspirits, shared
brainshrooms, ayahuasca, speciallyecule, itself. entering the Gaiat, in this way sweet
n Mind The Invisible Zero" alive the etherealtween Logos and surflaming equation BE
"light is thewhirl in a grain of means by which leads into itself. Bohentire universe
Andromedas galaxojection we could fly in our fingerprintfuture in the crystal"
Deep ads of mankind is one.own the consciousnes This is a virtual cr in the vacuum mattertainty because eve
er is one; cause emotions in million shared thoughts; data are linked wetube patterns
"Life and everphous Androgynous is ee more aware you areven more amazing, th
; to breathe and fuc consciousli the voice in the dispeaking softly like
di genital wildreness quality kitty iridescence,
hat can haunt matterinting. My first ufo, or people Fluorescent bullys Vacuum tube amplins
Tesla Pop-mire views and aspiraesla Neon lights Speedo war is the uv oven chief Microwav
nihilation of distalanet wavefunctiocular place of time-, else Id be a jade
sun. I loopiral she loothought inside sienter her reflectionear Isis (what follows is laughter and kundalini)
Bluelight of : yousleeping fired beings conceived crystal harp
she asks me in. to only dream is real. . how am i not
we are imaginever reason: i is another
gs and co-creates res. your friend springy unimaginable other
ending. not anymoreme? do you feel timeality.
deeply unbroken totalvasiv implicate other now i remembutterflies begin to crash into the galax
my genes, in highmmunications, institlue skies numinhummingbird femaldawn of mirrors and e archetype
epic electrical la la is a luminous rivrivering andax vortodomestics the leaves cut nature was born the passe eyes, the brain is he glass the sun the eatiful knife surf the lighe After Science:e synchride sunrays and trees
at silicon speed invented by BrionofoutBounds: Dreamachi2006Working This work was an i
or this purpose cosmic opera A Rainbow in the Phantom Band
) The Descending Moo71 improvisflights talisman indeterminacy inter-contribution
know yourself ring a multidimensiowiveron "A river eternal glimmering surf
on the..." . ce, it is the river synergetictronic on mirror wombecomes is the...
3) the Mirriver theon lyric

leT The loTus leT us love iT

2006-11-05T20:01:00.000-08:00

Letthelotusletusloveit tievolsutelsutolehtteL

LotofAgiA
M
(invitat)(spirit-Hopi-animal)))))))))))))))))))))
)))))
))))))))))))))))))))))))))))))))))))))))))))))))))))))))

Flourishing of a collective soul, it is said to be…
I just want to live in a pyramid way, life as s3Δ3s)(like occult masters have whistled)(-------------------------------------------
Really (reality of possibilities),
I don´t want no more plasma awareness, (nothing personal), ---------------------------------just wishing kind of planetary-poetry existence
- psiscience -

And where is the natura, at Uranus?
I´ll make some holes in my habitus.
Mountains make me cry –(unreasonable sincerity),
some silence(shhh) lessons, --- they never leave without a trace ----
Como guerrero que cultiva un espejo de maiz
(cornskin-maizpíritu, my spirit)
The context is no context, just click the belly.

(((Read the sacred letters:
androgynous geometry and textual kindness of a celt chimeney, )))
The soul architect seems like a bone serpent,
Kundal spinning into so much symbols,
(Mucha drawing secret girls)
Its like an oddisey to El Cairo, (save a bit of goat milk inside your closet)
(Odysseus did)

Idle words should stay at salty corners – (life as cliche can kill all vital mistery)
Between the Machu Pichuu´s and the Sillicon Valley´s shamans (digitaliza las hebras… amamanta el-la Mandala)).

And hey Eno, why don´t you play some nice vibes while we grow wild. (Kind of maternal mood: electric one)
Some crazy, some say lazy,
Caress the parallel existence, your hands wide open to eveningIshtar, --------------- as a digital virgin ----------
Skies are duplicating your feet (2¿2),
invoque a mental parade… drop it, find Mercurie´s nest,

AWAKE THE LOTUS

(eLe elegante
ELiphas)

-------------RIVER RIDE THE RIVER-ON-ME

Weave dear Prudence´s laughter (and then there´s loco´s bubblegum)
(he shall give birth to his own Belorofont (maybe unicorn) ------------ alex, al (chemy) ex, exHale alchemy alex -3- Hg –4-).
embrace planets, gift a glance to the dice twins (chaos cute babies)
001free0010binary11001genetics011
--- (images-silver-feathers)

(the swan is on its ventral way,
it is unstoppable)
… we´ll surf threw new unkingdoms,
sons and daughters of the mystical flower!!!

leT The loTus leT us love iT.

leT The loTus, leT us love iT.

....................................................v..............................

A (the) Mother (sacred), in need of warriors (quantic ones)

2006-11-05T20:00:00.000-08:00

Invitación alakash (party in Alaska, the dj is an iceberg, sweet technopale melodies, ice in my eyes, hey guys!, frozen furniture for everyone!!!!!!)
Sincronías del maiz (indigo roots) (beyond any binary state)

Ride the river…
Ride the raven…

Because rivers and ravens are writtable creatures,
“… and if you know the words that the world is made of…”
lenguaje allowing realities, codification of escenaries
(thank you writtable creatures)
blueblack infinite,
teaching, invoquing sky´s highlights,

Master Riley´s rainbow
Soft loop as curved air
En infinito no hay debilidades ( there´ll be no fruitcake (nor mysticism) for those who fear)
Weakness in fractal is only an anti-myth (stops producing realities)
mhmm, you´ll sure meet him.
Should never underestimate its presence, but also remember that the name of fear, is not that of awareness.

(but, master, where is my loop-ticket to sky?)
That´s bullshit my son. YOU ARE the loop-ticket)
: Ok
((((((((((((((((((((((((((accept the responsability)

And so Gaia needs to hear, again, the echoes of Quetzal-coan-atl,
(maybe wind´s predilect son (or is it father?)
that help sostain the 4 candles (one giving light to every cardinal point)
gather for planetary breaths (hada.inhala.hada),
renew mythical foundations
and, son, don´t talk to much…

MAKE IT HAPPEN
(easy happy face) (hoy por ti-mañana por ti)

…………………… Gaia-bonita-Gaia)

. . vvvvv V ^^^^^ Ç^*Ç****

Dr. Albert Hoffman´s Birthday

2006-11-05T19:59:00.000-08:00

The 11:11 family, strange loops parade (pyramid pi-llama) and flying bikes, (who knows not that smiling green sun gyring like a wheel, candy silverine in your mouth?) REPORTS: DR.Albert Hoffman the proud father of L.S.D. (his problem child, our mystic joy) turned 100 years old last wednesday, 1-11, we apologize to the cyberethereal Sunyata kids and cool cats who follow the glow of the lysergic molecule for our spectral godspeed -delayed in Napoleonic satori- we were probably forever, spliff and windmill giant butterfly fishing, Dr. Gonzo and firefly River lobbed us. Still we celebrate the birthday of the great swiss inventor (swiss means peace), who first synthetized L.S.D. more than sixty years ago. In honor of Grandpa Hoffy we name this day the day of l.s.d in all of the galaxy (Utopus Urantia):

liquid sky designs
lucy in the sky with diamonds
el es divino
el es distinto
el es dionisio
libelula sincronica dinamizada
luz de sirius deliriums
luz
de
silencios
divinos
(lizard
silent
dreams)
lazy
suns
droll
lady
siouxy
daze
lay
soft
dough
laser
skirt
door
lobe super
scan
dog
los angeles
son
dosis
lama
sathya
deva

to be continued....

THE RIVER WISHES FOR 2006

2006-11-05T19:56:00.000-08:00

In a spirit of entelechy dreamcreation -sending (chaotician control) remote IBIS birds into the wells of decision, of karma, of Anubis, and of Akash- we have come up with a list or prayer (inverse thunder) a sort of moving crystalball of words and prophecy: quantum voodoo thoughts thrown at the temple of the future: at ourselves, breaking the mirror opening the sea walking over water floating in the air; to see the future as an extension of ourselves, spaceship of our vortex-plexus, violet ectoplasm of our will, protean prosthesis Kronenberg (mountain of time) timemachine, psychedelic clay -chemical kindergarden-, smiling faster-than-light cat, the stellae of our mescaline breath blowing deers in the wind, to tread the path before
as we join our dreambeings and go beyond….

So be it: glossolalia incantation reef: 2006
Year of the Dog
Sirius be with us. (Wizard and Brightest Star let us ride the Eye in the Sky into the I-inside
from the silver surfer and the swan
to the center of the galaxy, whirl oz through)

We ask the Three Wise Men (Orion’s Belt) to show us the spiral path and the sci-fi tech, to take our wishes far and fast and fly with them into the womb of creation in Gaia’s blue liquid room. So the hummingbird hits the bull’s-eye and nests in the holographic lotus, quick in the silver blood of sap, eversurprised at “the deeper you go the wider it gets” infinite glow of the sorcerers door , golden ladder of ayahuasca, magic mezzanine, jaguar-mouth, into the axis tree, rosa mundi, final fantasy where the seven silver sisters dream geneticfields for us to be. And to enter their dreams, subtle seas weaved, and to wake in there dreams gnostically (like cobraforce release, Kundalini kids). We ask you, Wizards of Trinity, for your charms, your gold, your incense (in-séance), the gestalt constellation of your alchemy; the marriage of fire and water: soft fire, childhood fountains, Atlantis, liquid light, dolphinwine, love of the dog and the rats -white blazing wing of Blake-, love of the god (dess) and the stars, in excess and transparence, palace walls cleansed, perception whizz jazz symphfinite, the world as it is:
one.

We ask you also for other gifts, kind of anecdotic, playful spiders, into the galactic-all pharmacy, under the counter hydrophonia Thoth´s grail
todunidos por la hermandad holotrópica y el sonido futuro
del agua del brujo y l´aguja del demiurgo.

We ask like children in tropical fever, faithful, that we see unicorns
purple poppies, everpopping in the salad, in the mandala, near the swimming pool, as I drink elixir with you (which means exit the wheel of suffering, Buddha vodka and tangerine tree).

Unity in chaos (tragos cruzados, in-lackech brindis, balamquetzal, en el tapete del Nintendo volar, mandelbrotar del primer mar mermaidmermelade wildest fandango).

Unity in thought (in a silence kind of way, crows telepathic twilight entangles, rhizome of arms, roots, mandrake blasts, crossfiring synaptic bonanza baraka: the deepest crystal resonance).

Unity in fight (or flight, of the first Osiris, (again) against our own witchcraft, matrix boomerangs -psystembuster subtle dance behind the dragon’s eyes, near the palmtrees, unnoticed, ninja gazelle with the queen’s jewels in his mind, metalinguistic juggling of sliding doors, cocktail at hand, diving into the sea of Fermi, free).

We ask O Baltazar
For things to change
color the streets are white, the sun is green (naranja azul, la poesía) electric kauyumari, sunset soup, my feet leave fruits in the ground, jellyfish and maíz, in the sky rains avocado, and everybody is a quetzal as they wake (Kafka too), to stare at the girl with rainbow eyes -jade river-, first thing you do, shake dreams from your hair(ololiuqui weeds), choose the day, the day´s divinity.

We ask for sneakers to the moon, Jordan-air meets Mercury, sandals of wind, blow near us golden comb, Echo. Or Arabian cloudy carpets, nierika spacelifts, candy wings.

Hey Helium Elysium BALLOON

We ask to know (the song) WHO ARE YOU WHO ARE YOU?
me mingled with the mink of Ishtar soham.

That we learn to use the embedded wisdom (sewn thunderlight)of mirrors and all kinds of crystals. Phillipus Aurorus has one that is a sword or even a phone electricum magicum that, as Donnie Darko knows, is everwhere, in the holostardust. So I send my emberdreamquartz to the lapislazuli girl who is the stone I am the stone lapis philosophorum phosphorescent sperm in Holopolis.

That (for kicks for music muscaria) Mozart´s indigo blooms, learn to use protools, and quantum base Logic, so d.n.a sounds great, and orphic resonance reigns as cosmogenesis draws (DAWNS) near.

That we all learn from our multiverse fronts to make holograms. Meeting without moving teleonimic Aleph´s, Indra pearls, our nagual streams, Through art we are. Through all we act.

That the butterfly screams at the ear of the sleeping beauty diamond snow, melting sun at her ear, lifting and giving light the secret of Ishtar-Aztlan.

That the river finds its phoenix, nestling on the surface, inhaling cascades and pumadust, flapping its wings as Stravinsky pulls the chords and fire ignites water, seventh seal. We all jump holoceanically into turquoise bliss.

That the mirror becomes a river; the river a sea.
That we all see through the looking-glass what Alice saw in the stars.

Thank thee Alcyione Allisone.

“ Voices from the edge : FAIRY TOUGHTS AND SMOKY MIRRORS” (part I)

2006-11-05T19:54:00.000-08:00

Andogina luminae.
Constelación-Camino en azufre y mercurio, patrón reflejado con naturaleza tatuaje.
Vi un cielo tatuado en un planeta… over and over. Así fue mapeado…
Disuelve Tehuti, disuelve-nostrum
Entre las piernas de gaia, el pajaro Ibis anida…
El tres veces grande (net architect)
Configura los espejos sobre la tabla verde fractal: son trece superficies, una al final de cada surco, 13 surcos en el útero de la tierra.

As is above… so is below.

Mente cristal: entrimigestada
Conciencia quetzal: crea recipientes de luz: lux perpetua
Amentis diamante ---------- (pray-mantis) rezemos)
mente endiamantada, mente como diamante, y sí, puede cortarse.
… ! encuarzemosnos! Enmagika
Seven Sin Souls, NOTHING IS BEYOND UNITY todo queda en ethereo registro………………………………………… …………………………………………………………….some kind of akashic feelings
In my dream, i shared some stardust with someone… todos somos David Bowie.
Your mission: take Hawai corporeity from things, add some spirit to the body.

Uno ojo de oro puede iniciar caminos de magia, como al alejandrojodorovsky.
melodia: “espejo akashico, regresame a atlántida, espejo lunoso, encuentra mi ombligo…”De pronto, radio destruido, bien sabes que la mermelada de memoria jamás dejará de escucharse, orinas los restos del artefacto (fáctico orinable) y sales confiado a caminar, sabes que nunca esta solo… a cada paso un planeta recien configurado, en unos cien años según Sheldrake, le creo, … la conciencia humana como unidad hololúdica.

“future aint is what it used to be”…….
always that everchanging glance
I wanna live in Notre Dame forever, may I father?
… Quizá sea hora de comenzar a desleer los textos ¡”···$%&%%/)(¿¿¿*^¨Ñ_:;
in search of transforming the heavenly mirror tattoo.

enus V

some say silence is the K

2006-11-05T19:50:00.000-08:00

Some say silence is the key word and Ouroborus our secret.
Search for truth (which its purest form unites with an also precious lie)
maybe inside uterus (holostardust) unlimited matrix

Take a visit to your VENTRAL WINDMILL (como tierra humeda).
Remember the hologram´s skin reflects all vital sounds.

Sometimes amorphous,
sometimes melancholic…
hey crystal lady: why don’t we share some info?

And so wisdom has its own color beneath the mermaids skin… it kindly follows the fractal chorus…
and the why? .. it has no answers my child…
... Apparently, naïve melodies could scream you to death

Catch the ghost in the rye - unique expressions
silver swan has also bluevelvet eyes, ((the real magic of parallel existence))

Vanishing “house of the rising sun”
Solstice body, sewing skies (why could it be?)

A drop of conciousness inside every iris? (we could all love the game)

Dream a web
Weave a dream
silence highway

silenceshhh

V
7
V

hic pueri piruetas

2006-11-05T19:46:00.000-08:00

Casi como catéteres lunares,
catárticos sirios
(cínicos)
sibaritas que palpan palabras
quieren trocar el trueno por trombas de esperma sagrada.

Salvia (VIVAGAIA)
que no agalla
ni llanto,
Sólo salpica escamas cárdenas
(lepodoptera in nymphae mutabam)

in cuicatl canto, cicnus
de coral calcáreo
rojo
Rubicon
Rorifer:
Rocío silente de baba muktananda

esparcido al aire la tarde del 11 de julio
cuando el niño, (hic pueri piruetas)
perdió el temple y las corneas (11 53 57)
con coronas (13 24 12)
y perlas de Baily (14 47 36)
en el espejo de 1991.

em

BIRD: BIRTH:WORD

2006-11-05T19:43:00.000-08:00

IF THE WORLD IS CODE WE CAN HACK IT....

so Terence speaks in Palenque´s psylocibin drift...
monkie holoballoo, sara-wato sage, THEY go out of their limits, for days, looking
for stale fruit... just to intoxicate, catch a glimpse of otherworldness...

so Terenece says in the african grasslands of the Great Horned Goddess, language became... holy cowshit.. milenniums dust, energy, spores, the passenger spoke...

Everytime I see a mushroomcloud i know... novelty, concrescensce...
I can read d Escathon
(skid the sky or die) heaven is the mansion inside the mustardseed
THERE IS MORE ENERGY IN A CUBIC METER OF VOID THAN IN THE WHOLE UNIVERSE
a thousand buddhas whirling in the dust
Sunyata secret roar
cock of gold (el amanecer) "el mar de testiculos de oro" dice Haroldo
let the waves say the word that is sex with the air
Ehecatl
coatl copulate with the invisble Flaming Lip
speak
now quantum warrior

bird of the underworld
bird in the motherboard
bird buried in the void (jeweled bird)

fly and say (ceiba syllables)

“… and if you know the words that the world is made of…”
Vitriol Crane paraphrase : you can play
"reality is whatever you can get away with.."
the game break into the(chaosmic)egg
lotus lotery: you can win Padmes plenty
Lot´s wife -lux et voluptas-
(know the patterns, know the waves)
but something better hides

"beyond the binary state"
we should go where paradox leads oz
"the way that can be spoken of is not the Way"
the tao that can be taoed is not the...

irreolute in nothingness i stand to decipher the language of the stars
(which always reveal my name) astrolabios se leen
no puedo salir de la red
cuyo nombre es Espejo de Hermes
para leer hay que dejarse caer, en la sangre amarilla,
en el foton fetal, ¿que dice la placenta ourobhorica?
el universo se quiere autodevorar, el fenix incendiar-
beso la cola del quetzal.

O el lenguaje de las aves, fina escritura eólica:

Thoth saw them flying and grabbed a feather and drew
as following a telegraphic mirror-like intuition,
the words: Hiburu, the bird:light.

in the screen of clouds
in the byblos of sky
birds write as they ride "ride the raven
together 's... blueblack infinite"
system of signs, their flight
is collective mind mirror´s dance

Know that text secret reader (hermenauta)
-birds-hieroglyphs- river -ibis- in aether
the reification of spirit
silence (the door out of the text)
(the glow in the paradox)
time stops like in a movie
where the character steps out of himself
to contemplate the end

What is out there?
but a bigger bird(th?)
body that contains it (qbit), the isness of the otherness,
Jung said "the UFO is the mirrour of our soul"
Borges "una esfera (tornasol) cuyo centro está en todas partes
y su circunferencia en ninguna".

O greater bird (i think of a malayan tiger called undeath,
of Ezekiel´s burning spacecraft)
Eagle of Energy (as Castaneda leaped into the abyss, falling, a radiant
eagle davoured him) we feather you (iridescent infinty)
we fade into you. We remain?
in abstarct flight, in the holosyntactical sentence,
constellated, logosbreath.
Disembodied meme, livin only in the link of the web,
is it the same?

como afuera, adentro

esmeralda en mi pecho sin cuerpo
"boy the void is bright"
Bohm, vacuum, Bohr azor
go, intrauterus Beyoncie
born from quantumfoam
i go deeper than my cells
where you ask
if i utter the word: i am the world

un águila en la falda de Guadalupe
in the abyss-me of she
abismismo
el fondo de coral luminoso
las estrellas en el polvo

inmenso animal: el silencio cósmico
(boca)
utter us
alpha virgin aleph

Inner melodies I

2006-11-05T19:40:00.000-08:00

*^P¿??=)=================================
================================== =======================
====================================================== ======================= ======================== =======================
Sirens crawling, deep inside my ears…
but, do they really exist?, i mean, my ears, are they real? … And what the fuck am I?
Answer:
maybe = universe

I am a sound, you know,,,,,,,,,,, we all are, crawling siren sounds.
And that’s why I don’t believe in Yoko
… she sound’s like a building. ((Dark Dakota could be crying at this instant…. ))

IntRo in search of cultural amnesia

??? ?
? ???
??? ?

let there be at least, seven models, breathes, for everything, Hagakure-Wilson.

Metaprogramming an octave of energy

evolutionary wave,
- ride it,
- im trying,
- Do it. -------------------------------------(future’s architecture)

“life as we know it” … quite smaller than we think, it is the concept that punishes us,
faces, we know it
releasing your senses towards happening
spaces, who follows?

(try fonetic realities)

why?,
wise
why? the white sounds,
wild

It is a gift, you know, it is the Infinite Heart Cinema

----3-----1--------3 -------V

mantra from riveron lands

2006-11-05T19:38:00.000-08:00

a riverous chant:
from forms to mirrors

river ride the river on
awakening mantra (soft and golden)
river ride the river on
crow lays on ludic ground
river ride the river on
trinity unity, one to three symbols
river ride the river on
heartly toughts
river ride the river on
belly's jelly growing tenderly
river ride the river on
a school class in Efeso on St. Paul’s day
river ride the river on
Anu’s daughter has a secret garden
river ride the river on
Castor, Polux, and us, con al-cohol árabe en lemuria
river ride the river on
ego sum qui sum (collective starship)
river ride the river on
ma(gic)ke it happen
river ride the river on
dragon verdevora sol
river ride the river on
liquid paradox, sincere tear
river ride the river on
glimmering wisdom (breakfast at Zion)
river ride the river on
femenine planetary courage,
river ride the river on
shakti -acting- visual freedom
river ride the river on
777, as androgynous sinchronicity
river ride the river on
holohappenings' party
river ride the river on
...
river forever ride forever the river on

HOLOWEEN girl of river (treat)!!!

2006-11-05T19:34:00.000-08:00

(quetzal-river-phoenix)

todosomos
quetzales fenix rivers

Happy Holoween!!!
she said,
out of the blue flaming bush, sufi
whirling and dj eyescream
with her vinyl silver nail
sending me into vortex swivelling sendero-
girl name Tao pascua robin violet-
riverran down the rabbithole
past Adam and Neo
-garden of Prosperine-
tea with Lao
candle lake,
spinning cups-
the King is death....

spinning haze (low-lit)a purple air
golden apples of the sun
(silver of the moon)
lets go to the woods
to play with spooks...

Holoween by day...
Hamlet's pale-self
infinite space
in a crack-up
caramel or shell.
RADIOELECTRIC
waves in the willow
catkins floating elves
Einsteins scary hair, lee
whitelectric snowflake scratch
fractal superape perry
scary spaceship
zombie cat from outer space
waking finnegans girl
talking trees
i learned telepathy
from the bees
hanging from (chillin))))))))))))))))))))))))))))
the wheel zodiac synth Isis
Madame Bla Bla bats key tunafish tune attuned aware
sound that dear astral bell.

Yeats masked circus animals march
botargas platonicas, linternas
de cuevas plutonicas
sirenas de neon, antrompomorficas
piedras, estalactitas, el arpa,
la cuerda y el dragón.
G&%%what do you want to be
boing the guanabana siriuscolibri
in the center of suns voy
where alchemy is forged
heavier elements are born
from androgynous hydrogen
to solar rain femenine silver
and silicon Valley of Dolls
and pills a moonpill for me
please Inana, give me
white chocolate dancing skills
aquelarre in Tarkovsky beach
vanilla fire and r&b.

Its Holoween!!!
girl of grass
hologram eyes
softly passed
flashing me...

We play hide-and-seek
while still asleep,
suddenly in the crystal forest,
Mononoke.
monks and mummies
confusing monads,
Leibnitz.
¿somos holones o no?
hologoblins germlins
in the jelly of Alcyone.
Shimmering in the east
pumpkin in the sky
(give me my candy treat)
Alex Gray jaws chakrahorse
orange(sun)crush driving force
sound of laughter
quick, now, ever...
and she´s in the lilactree
wicca wicca
burning koala
eyes of Lemuria
arrow of the little-god
finds me.

Very Hallow Holo Hi
very hallow holo hi
girls pass bye
say-sailing the blazing breeze
bye and bye
so many as the leafs
and all the same
with costumes
priestess wedding
the heavens to the ground:
colibrijaguar
koalacoatl
weaselhuitzilin
axolotuswan
gummybearquetzal
crowlynx
riverphoenix

holothrough
holo-we
holo-youel

risingrye, catch the ghost

2006-11-05T19:31:00.000-08:00

Toth's doll... (she speaks with the birds, in such a lovely way (highway to vitriol))

2006-11-05T13:42:00.000-08:00

.
.
.
my name is SOROR - - - ((()()())) - - - - mystica bonita

Invitation. from riveronmirror to Mr. Yeats' riversoul

2006-11-05T13:39:00.002-08:00

hey mr. yeats, would you come to the river on lands and show us 64 bits of .M. ?

(whiskyghost corner)

2006-11-05T13:39:00.001-08:00

SCINTILLA ANIMAE

from old have followed the road of light.

Rhea's tail, skinny cow,
Coatlicue's wrath
ribbon of Ishtar
and the sevensisters
hanging around in balconies
maiden-like and made of quartz
holy in ivory
throwing signs
in the suns wind
winged whispers
winnowing maps
that tattoo-you-blue
Azul tatuaje de la alta imagen,
Semejanza del cisne
Where moons surprise us
as written withe knife of night
“ the only truth that cannot be tomized
is light, the only naked body,
the Sword inside the Stone”,
and nude star (como la nieve)
in the window flash.

So to say we are the Thirteenth Tribe
Like the balam, and the lemuria,
who follow the baktun into the Mouth,
rain in the thighs of the Jade-Jaguar,
jaderain in the jaguars blood-jar-
is to say we follow the river high,
stoned to the base, entranced rose,
spots on the skin stars of the fur,
La escritura de dios, el tigre invisible,
where gently -¡River in the Sky!-
flows our way, through the same body
of a mirror’s multiple symmetry

espejo de obsidiana
etznab mutabens
multiple maia
Nile mirror
whitesand fertile
spermatozooe
Zeus´s stallion.
Starlion
Sphinx
Scorpio
Signs for children
looking for mother
Alacran en mi sueño
sobre tu ombligo
descendente
como Marte
la roja cicatriz
por siempre
la espada en mi mente.
Madre de la luz
claraboya
Araña inmensa
Sombrero de Merlín.
Mother
KALI
calls
gardensoft
voice
strong
volcano
lotus.
Gaiabove
love
boat
Isis
has
our linga
gold.
Children hold
to the serpent belt
or sudden photon belt
phoetus salamanders
turn into fire
in mothers dress
blue pink and green
Guadalupe´s sea

because we love vortices
we love vortices
vorticism lovers

matrix delivers us
spinning inside carrousels sweeping
light
chimeras candyflip
hair blazing like nebulae (:beatlejuice bijoux)
body compressed jettisoned
spirit silver bullet butterfly
looking into the nest
spiral eagle
eager to rest
forever mother forever motherme
close your eye with us inside
whiteholeus (your ears mermaidshell)
dream lotus let us know the dream
that dreams us
dream the dream
as the spider is the web.

Follow the whitebrick road

Wizard in the desert

Crocodile opens the mirrormouth
eats the Nile
CHILDREN kings
looking for the nipple
behind the veil hail geyser
Queen Electra
Sister Alzion
spurr the milky splendor
the greatest flood
that turns crows white
and blood into gold
crowns us-
with the invisible light
of the flying door
_____
! !
! !
! _____ !

VEN a noUS

2006-11-05T13:37:00.000-08:00

Cuando se rompió el primer caracol que parió Venus, todas las vulvas vomitaron volutas (violetas) de humo y los quinientos murciélagos, estimulados y extáticos, les mordieron, a cada una, la concha. Entonces vinieron las flores y los días nefastos (nemontemi), conocimos el desdén de los tobillos prístinos y blancos, aceptamos que las flores, las vulvas y las conchas son un guiño azulado (casi quetzal) de ese dios vapuleado, que se fue con las alas dobladas por las playas del este. Tú las traes Lucifer.

em

graphics and biology

2006-11-05T13:35:00.000-08:00

Graphics and Biology,
life as an unlimited design.
Holography
Narrative notions of a He-story, (biographical whisper)
--------------------------------------------------------------------------------
Aether architecture, as a she,
a she who is in silence
------------- ridingriverouswaves, giveaway everything,
galactic glimmering gates,
(como suerte en azul-ojera)
-----------------------------------------------------------------------------------
mystics inside a Budweiser can, prophetic dust and jeans.
(some say Waco played an anti-paradise role)
David´s star????
Spielberg’s new masterpiece???
(((Found a bit of cowboy’s venom in his pocket:
smells candy-CIA))
------------------------------------------------
hackakashhackakashhackakashhack-
-----------------------------------------------
… el venado en el viento, (bienvienevientovenado) –“spirittales”— one after the one… and then another,
yesterday, tatewari y un tatuaje (piel panteista--- as Alice in Ultraland).
---------------------------------------------------------------------------------------
God, and how is the owl wise and frozen?
- because of his chrysanthemum soul (speaking in ehécatl language).
“auricus octopus and a winter horizon”
(he’s reading the new fragmented literae -----
...and welcomes you to it ---
-------------------------------------------------------------------------------------
is that what you call kaleidoscope’s science???)
-------------------------------------------------------------------------------------
Eris-iris, in cotton-swamps you rest, D
Somehow dissolving my limits.
(Not sweeter than my Soror, but in so a silky way)
Hoy hay dioscuria en Lemuria, singing seed songs,
toloache-free party, no datura for the children, better to follow the talisman lady.
--------------------------------------------------------------------------------------
Yesterday i dreamed with this Scottish pagan festival, where half of me was conceived around 20 years ago.
Some celt seeds sparkling, 7th aurora borealis, auricae woods marking maternal rhythms. (like the chant of the siren-druids)
I noticed the moon’s silver warmness, delightfully encounter in the eternal belly -----0------ auricae ----------------- the gold is finally amorphous (hikuri stars… el venado sabe su camino).
---------------------------------------------------------------------------------------
Me inside a versaladder (of verse and versality, a stairway),
surrounded by fractals, corals and spider man, saw some words written: “for sure code breaks”… and then:
Zig Zag blacKkk
… I slept for 27 pieces of Luna. I woke up lying in front of a crawling crystal river. He was speaking of some ethereal-geometry road.
“This road, he said, sure takes to Chartres labyrinth. Walk it, surf it, and then, when you get there, you shall meditate an image of the Fairies flower”…
--------------------------------------------------------------------------------------
The dust shall witness the flesh, over and over, till it un-becomes
Lou, the one who grew up in a small town (hippie anonymous small town), knows this.
Nico, femme fatal, didn’t.
Andy Drella, maybe did.
----------------------------------------------------------------------------------------

part 1...

deliria in realitas fatua (sorry for the retching, and the sermon sperm spam) had to

2006-11-05T13:34:00.000-08:00

the mupPETbabies (Is Nanny LUCIFER?
higher than sequoia in L.A. Starwood,
higher, skyscraping Babel, burning tron-
her ankles –she took venusfire first burned
the ocean, the seashell cradle song cop-
are higher than our scratching hands-
nanojiraffes velcro trees-
chalk chalk, hissing the wall,
silver nail in her ankle: root of crow)))

((((((( ))))))))))))))))))))))
(((((oh look the Cocaine Monster is in the roof
in the room in the red white book
boom the broom of the redlight
takes you eats you and you
know not whats true))))))))))))))))

THE muppetbabies- they have murdered reality
orangeblack static – Tuttankammon gun
voodoobolt over Napoleon’s chakra sun-
memory boiling in the pond-
Goat rejoicing in the pool.
Mummies revolt.
The newspapers ash- tundra flash: cyberia
is white fire- up for grabs! the Cableguy
fights the Mosad to generate
a widespread viral dream,
sexsixpoint star, vital screen,
Pan’s playground, Circe’s siren,
it seams It seams it seams it seams
it seam it seams it seams
everybody eats the fake forbidden fruit
(fruitcake microwave win the sin)
and casts itself on the cosmic tv
warholy wormholy electric king
nice teeth orgasm layered happy happy happy
ive fucked Alice, done buisness withe aliens
(gray gay gay its all game) b om b timetech cock
got a hold of the elixir’s nothingness
Burroughs uncaged bird boxing bonzai flower
NOTHING IS SACRED everything is square-
lady your light debauched– de-lighted
crow feasting –milky thighs- wounded womb-
winnadigo- theophagia- serpentskirt:
the sky colonnized, the moon’s dark towers,
sending signal eclipse, egodeadly waves
your own face (eraserhead) mirror
you like “in his likeness uncreate”
terror spinningarden gravy candy
the sauce, the beautiful vampire,
the flying Faust, the empire,
he smiles (you smile), he winks
“and He came with a winged army,
riding the clouds to deliver
a frozen dummy, a snowman,
a white image”
the Secret, worthless.

..............................................................

THEY HAVE MURDERED REALITY
EVERYBODY EATS THE KING’S BODY

-------------------------------------
so they think crows will grow crowns
and they will rule wild over their wings

-------------------------------------

kiss anarchy kiss the mirror
splintering boomerang knives
kiss the clown sleeping with the queen
kiss the screen of your dreams
jestering eternity
now is king
reality eclipse your lips
moonburned projections embrace
the strangling attractor: piggylotus

-------------------------------------------

nanny gave me the strangest soup
datura darkest inoxia
the thorn of the rose the holocaust
the soap opera o.d. table
anesthesia anathema

...............................................................................
kill the kethamine kat
kill data kethamine kan
kool ku kux klan

ash mercury, black cross (whipped whisper)

2006-11-05T13:31:00.000-08:00

Mystical greetings from riveron to hoy holy miércoles de ceniza
Pretty tattoos for everyone
(Wednesday windy ashes for reflection)
long live crystal dust
long live spirit...

en miércoles de ceniza

AURORA: OUROBOREAL US (Auroad Ra follow rabbit in the sun bear us. Chant to the Northern Lights)

2006-11-05T13:30:00.000-08:00

The river took us to Iceland,
Aurora Borealis capital of Gaia.

We were followin a glow -as always-,
the sideglance of a comet-rabbit’s
shooting whitestellae smile;
but it got into the blue butter legs
of miss A.B.: girlwolf
of “ the glimmering gates”
body immense same as azure
liquid sapphire melted twilight
the crazyfire got into her belly or vortex
or entered the vulviform sun,
silverdoor-
faded
fancy
frenzy-
glam-trascended,
the fucking rabbit,
delighted in vanilla velvet
of the sweetest underground
and magic mermaid mermelade.

So we had to go looking
for our other -quicker- self:
astral bunny burning
inside highest helen
oven heaven.

Our buddy and mind
in:
Athanor azul de la falda celestial
de atlantis piernas de delfin
(nariz de rubi)
en la misma raiz
de Avalon e Iggsrdassil.

Y llegamos a Islandia
“where the floor is a mirror...
all through the sea, which is another
mirror, blue door of the pinguin”.

El aliento del unicornio
se cristalizaba instantanea
escultura archipielagolabra
la palabra visible,
transparencia de marfil,
espejo teledirigible:
el cuerno sobre el mar
con el cuello azul
y iceberg eyes
iceberg rise.
Relincha suavemelodia
el unicornio de luz y sal,
como la torre o el sudor (yegua de metal)
biofania- cerca de la nuca de la Reina
en el ajedrez de cristal.

Aurora Boreal is
Llegamos en el unicornio-vehiculo-mental
A esta tierra nivea
(el axis mundi en el radar)
queriamos inhalar la mantalahska (notre dame ray of light)
que llega hasta el fondo de (l) (coral) cuarzo
cuarto de lemuria ceiba fresno arquitectura (aether ash)
centro de la tierra Julio Verne (ayahuasca blanca)
escalera de la serpiente polar (Lovecraft)
inhalar la mente de Disney (da vinci delicate)
la raiz de la nieve con la luna
diadema o agujeta de vuelta completa
11:11 angeles en la punta de una aguja
volar haciadentro
como el cometa en la vulva

Salimos como el conejo
de la oreja del mago transexual,
tornasoluna: con celeridad,
por el tunel en el hiperespacio;
curva del solzar, (Zoroastro dreadlock)
eje magnetico,
Houston-Holbosh.

Y el latigo cuantico
solto el trineo
-horizontal relampago-
sobre el ombligo del craneo,
sombrero de Merlin
long live !
en Urano azul superhipotalamo!!!
of our planetary brain whizzy crocodile
noosfera nostrum
this is where the crystal backbone
(moleculae wonderthunder)
of our epigenetic fields is airborne
like snowflake firefly trigger tangerine
-memory stones made of thoughts,
softer than cloud’s cotton coats.
El mas blanco copal, albino perfume
de quetzal, se recrea en la transpolinizacion
de las hadas hiperboreas con el tulipan...
Ultima Thule, tierra de Nuncajamas,
y a la vez de perihelio el peligro
del barco, la valkiria y la ballena
(the vaginasky revolving zodiak
....in the whaledark wormhole
-- glowworm glowworm glowworm><>
tunnel of time Darko Darko
antorchas adentro de orcas,
Rognarock, desfiladero,
barranca de meteoro,
el neon en el ojo de la sardina
dictamina el lugar de la fiesta
como el aguila en el cactus
la mitologia selecta de una vision
colectiva, la luz secreta (sendero, cenicero de estrellas)
en la falda de Fatima.

Yes, yes i think i was in that party, alaska, akasha,
fucking frankenstein (chuck in balls in chakra church) wakingup in chicago (technocradle)
Iceland or Noah’s arch. Dj iceberg
mixing mescaline with birds
beats vibing vintage mints
violet spirits in ololiuqui rings
all ove the planet is pumping helium
laughing hi delirium
antigravity the joker and the flysing spoon
(reality is a globefish in the sky with quartz-jaws (on m.d.m.a snowrush)
beneath the earth rocking the seed)
and hear here St Germain old man
sounding the horn and the pie sounda sat chit
ananda St. Germain violetsoundarms phi pi fi

thunder trumpet the archangel
disguised as a frenchmen
blows-up the voulezbard

where we at were we at
(omphalos)
(and aKansas)

(diggable planets more than southafrica)

dive in the diamond

mellowyellopath Santa with the younicorns
(Mazzy Star Bethlehem bead grid BRIGHT)

18 seconds till dawn morning glory bud

where we at akash meet alpha

flying-mat (4d Alladin)

The spaceship moves into the dress
of the gigant woman calling from dreamtime
(alcheringa rainbow alchemia)
caress of precognitive arms
willow sprouts (telecast)
omegamultichrome spidertree magnetrix
weave-us-with
in equinnox bliss
reparadigm axis kiss
virginlight seal
solar souldier search

f U z i o n i s o u r w i s h

auroradevoranos

au roar a nous

river on lyric

2006-11-05T13:29:00.001-08:00

by this river

brian eno

Here we are
Stuck by this river,
You and I
Underneath a sky that's ever falling down, down, down
Ever falling down.

Through the day
As if on an ocean
Waiting here,
Always failing to remember why we came, came, came:
I wonder why we came.

You talk to me
as if from a distance
And I reply
With impressions chosen from another time, time, time,
From another time.

...

icelandice for the eyes (bon voyage diego, -iceye-)

2006-11-05T13:26:00.000-08:00

Human Genome: First 13 lines of Chromosome 1

2006-11-05T13:23:00.000-08:00

GATCAATGAGGTGGACARCCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCAITCTTTCAGGGTTGTGCTTCTA
TCTAGAAGGTAGAGCTGTGVGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT
GTTTAATAGTACAGTATGGTGACTATAGTCAACAATEAATTTATTGTACATTTTTAAATAG
CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAARATGGTCAAGGGAATG
GATATCCTAATTACCCTGATTTGAOTCATTATGCATTATATACATGAATCAAAATATCACA
CATACCTTCAAACTATGTACAAATATTATATNACCAATAAAAAATCATCATCATCATCTCC
ATCATCACCACCCTCCTCCTCATMCACCACCAGCATCACCACCATCATCACCACCACCATC
ATCACCACCAICCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG
TCATTATCACCACCACCATCATCACCAARCACCACTGCCATCGTCATCACCACCACTGTCA
TTATCACCACCACCATCACCAACATCACCACCACCATTRATCACCACCATCAACACCACCA
CCCCCATCATCATCATCACTACTACCATCAOTTACCAGCACCACCACCACTATCACCACCA
CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCRATCACCAACACCA

Emerald Tablet

2006-11-05T13:21:00.000-08:00

1) It is true without untruth, certain and most true.

2) That which is below is like that which is on high, and that which is on high is like that which is below; by these things are made the miracles of one thing.

3) And as all things are, and come from One, by the mediation of One, So all things are born from this unique thing by adaptation.

4) The Sun is the father and the Moon the mother.

5) The wind carries it in its stomach. The earth is its nourisher and its receptacle.

6) The Father of all the Theleme of the universal world is here.
6a) Its force, or power, remains entire

7) if it is converted into Earth.
7a) You separate the Earth from the fire, the subtle from the gross, gently with great industry.

8) It climbs from the Earth and descends from the sky, and receives the force of things superior and things inferior.

9) You will have by this way, the glory of the world and all obscurity will flee from you.

10) It is the power strong with all power, for it will defeat every subtle thing and penetrate every solid thing 11a) In this way the world was created.

11) From it are born wonderful adaptations, of which the way here is given.

12) That is why I have been called Hermes Tristmegistus, having the three parts of the universal philosophy.

13) This, that I have called the solar Work, is complete.

Fulcanelli 1964: 312.

So... how does it feel?

2006-11-05T08:53:00.000-08:00

Did you know you could smoke success in a bong?

2006-11-05T08:52:00.000-08:00

...Bill does..

In the Garden with Dr.Terence Mckenna

2006-11-05T08:51:00.001-08:00

Critique Magazine_: "Well Terence, now I'm wondering what you think the ultimate goal of human evolution is..?"
Terence McKenna: "Oh, a good party..."

Sounding apple's blue
Grab a piece with minds glue-
Cyclops in the sky
with a telepheric ray bend down-
Logos hang shimmering from the boughs
---Garden or orgy or ufo
The fun of it cannot be plucked
By a zealous CEO
-------The tree speaks
Alphastate words
Clouds draw fading masterpieces
Winds silver feet kiss them
Digital phoenix nestles near
Unicorn virgin dreams closer
Perfumes winnow pervading
Chakric windows -the blazing speed-rivers
In ghostly trains leaving-
Images timeless from akash like feathers
Plumed codes and layers of energy-
A floating pyramid teacher
A mating ethereal flower
A classroom sacred with geometry pulsating
And changing kalideischopic tetragrammatons
Sapphire sephirots instead of blackboards
Whispering girls of the woods
With flying formulaes in stolen books
And painted archetypes in their legs
Boughs drawing golden near from the ceiling
Ethnobotany advisors bringing crystal pipes
With snakes of light and orange dust chrysalis
Silent bells of trance- spacetime- elves
With miracle machines making love
To music in other dimensions –gloss so
Where diamonds flow –halcyon
Readymade summer holographic kits
Gifts girls dig diamond faeries behind
Eyelids quasars and galaxies
Revolving like the wheels of rollerskates
In saturnian rings -rainbow quetzalcoatl fields-
Roman nights of wild wolvering
The skin again electric -venice beach-
The steamy sea photovoltaic
With plankton and coral jewels
That venus brings as incense
And foreplay frolick mandalas
For sex fire vanilla orchidolphins
Beds that lift us into amber spheres
Where we play polo in a pool with the seven
Sisters of the Pleiades dipping koolaid light
A daikiri so high could make u never die
Like that fruit from that same tree
Axis mundi mariasabina seed
Blooming original superstring
Off of Orions navel capital city
The blue bead ololiuqui stream
The blue tangerine that started
The dream of cows giving monkies
Food from the stars and speech
To organize a mirror back
Silver-back gorila cry to the moon
And the digital totem of the replicant
Cry for consciousness -oh Centaur
A mirror back to the original stars
That gave us but a part of their superminds,
And us to find the brainsaw pieces in plants
Gentle spirits that yield their secrets
To our dancing keepers of symmetry
By the firesand the numens singing
And healing with stone’s frequencies
Sending spectral eagles into our bones and ears
Medicine drums of synesthesia and gaia-glycerine
Igniting genetical aeons of slumbering helices
Rebel reptiles and sian sea vehicles
Out of the deeps -cells symphony brink-
A sort of click and thunderstorm neo
Where memes flow with muon guns
That open the doors of dystopian lords-
Topple a sort of overmind babylon
Long held by faux gods s-thriving to occult
Our right to percieve reality as our pond
Our prom, to breed our own, dream,
Bake starship candy, bail from the wall
Or photon jettison into imaginal maybe
Unrestrained by a lock to feel
The multidimensional waves of the holodeck
And the a-thousandfold lotusun.

....
And back there where it (sh, sh)star-ted bear
Where eyes where undivided from rivers
Suns sounds applesilver moons women
And birds psyche-delicate lush launched
Sylvan glade gliding space glass looking
For themselves and past into other’s vortex
Sexual vortextual tangosigns in vacuaa
And a magnet drawing them one mysterious
Ravaging from m-other de-lighted chaotic
Creating time to be a party before-math
Where ouroboric pills are hidden to find
Like a golden bunny in a pharm.

Win on a sky (colorider)

2006-11-05T08:48:00.000-08:00

.
vir gin thief ///////// shop lift some feathers (cromalsd((

While wheels joining wings with kaleidosquetzals
Would you share, i mean, will we live in clitquartz magic sphere forever ? -l- ?
May riveron find the everwalking dream (wombomb-wirikuta-earthwake-fallingfalus-everything ascending((?

let us fly, uf i teenstops, reef memoirs, i will never stop your weaving ....

endless day and endless night

.

riveron question

2006-11-05T08:47:00.001-08:00

Have you ever felt a wild happines at the exact momentspace where when things crumble whimper disintegrate?
aphex vortex.
when void blows unholstered unhinged deconstructed winds of disorder
with no one without a thought system or a cigarrete hassard music streaming
strange faces ,,, but uncruel not standing on others lack of understanding
fiendly end beautiful amazonic pulse -- the golden queen of the hive
smiling with deadly dart darling at u --- and a sort of yes
libertine blind passage through redlights--- no more lies
lying in never a fever delirous ruby
and earthquakes are the deepst mass age mess age
messing around missing none just like a crack in reality
where a firecraker empire blast around, smoke-in mirrors crack
sky torn personal apocalypse ==jus fun for the hell of it amoral
love storms
psychotropical mad crash
didnt take any drugs today but triggers are in the air
psy synch hi sci fi pie skybugs countervenom drops
tox fox savoir crazy weasel nonchalance
Have you ever felt so more untouchable (firstly bulletproof) at the face of the loch ness monster, like nothing can happen to u
when everything is about to blow up pieces splinters in your most sacred fortress everything you clinged to
all your dreams and desires broken bum glass and all of them boomerangs to fuck u and u can fuck them better but yould rather just remain watching the great specatle of destruction, glimmering with privatehoruseye -secret lights?

Unicorns vs Phoenix (ride the unicorn)

2006-11-05T08:45:00.001-08:00

Unicorns are more fun than phoenix
Although pheonix are highly sexual
Unicorns are alluringly virginal
And like to graze and frolic
Through the fields of blue grass
Their horns are filled with subtle
Serpentines that pop out
Of angels armpits and tickle
Chameleons genetic resonance
They mean foam (soft venus) party
Like pebbles and sand castles
That become clouds, loftier
And etherealized, unicorns
Are more like the holy ghost
Messengers of mother magic
Phoenix are like the heavenly father
All wrathful and with an uncanny fire
Blinding and enthralling
With the suns empire
Not as dreamy and gentle but devastating
With unyielding fullfilment
Rampaging deserts of gold
I guess one shouldn’t choose
But im immature and like silver’s
Cool feeling and moonlight
Rivers with girls appearing
(stoned immaculate images)
You might like a phoenix better
And its ok different tempers
Mix in alchemy as we reach
For a higher chemistry
Grasping realms of diversified
Energy and experience-
Endless. like imaginal
Princedoms playing with mind
And matter. endless
The beings that consciousness
Breeds. and i look at the garden
Where floats an egg of white light.
ominous. Somehow there is always
a carriage that takes you into the stars.

skid the rainbow

2006-11-05T08:44:00.001-08:00

Saw this other skittles ad -i busted Ishtar-:
kids sitting on a mirage.
Rainbows are made by mind,
like a candy garden
before time.
Kids gather to look for rabbits
(and thats glue)
kids eat spirals
and follow rivers glowing
dazed by glass
ang glacier
and laser
crystal pie.
Sometimes eyes
come by
with skies
and ask silent koans
like
i like u
do you want
a piece
of this
peyote star
it has so many dabs
its not even real
but i have it in my hand
and Gotlam is melting.

Smiling when its all ending,
thats the pass.

Threesome at the rainbow;
kids follow girls;
sometimes it all comes together
and there are
liquid trees.
A skittle for u
a skittle for u
and a skittle for me-
in ur skirt (and thats
the obvious follow)
there is a blue lotus.

Eating candy
is sacred
as fire

as circles
and sirens,
and screens.

The rainbow project
over a city wall
where kids sit
and eat candy color
pencils fish dharma spoons
pillows bliss air scotch
ice alleys under the counter cough crows
seven yellow desks and daddies
eat rivers and clouds
that could be
anything

a rainbow fringe
whre kids skip
to eat candy
and dream
over the city wall
and when they stop
we fall

Silver Mirror Magic Moments

2006-11-05T08:42:00.000-08:00

On the film "Donnie Darko" we have an example of vision amplification and mellow sky confused with the body of a girl. Donnie, who is a Riveron friend, holoween supercrack, sees what Don Juan Matus, the sorcerer Castaneda dreamed, calls the wings of intention, will and whim made plasma in its visible form. Streaming ectoplasm from the vortex-plexus, a totally psychedelic jelly that reveals the text of thoughts. People going for a beer before they go or a secret unfolding memento like the glimmering mirror inside the cellardoor. Specially after Donnie had teenage sex with candyflip Gretchen and he walks down into the party and it starts to happen, the weird clairvoyance under the milky way song. And he is in a sort of trance near the fridge and the halogen light seeing the rattlesnake tunnel of volition quivering around and transforming into sky like a rainbow wormhole and so blue its amazing, the clearness, the high bliss. And then he opens his eyes and he is on the floor crawling into her girlfriends belly eye which most probably triggered the vision, the fusion of sky and timetravel with her body. Makes you think of blue vortices andthe gift of seeing connections everywhere and following the quetzalcoatl (la vibora de la mar) windriver and all the colors that spiral in every action in its softest core.

It's certainly no coincidence that people who have taken certain psychedelic substances report on a very similar magic mermelade oozing from the body into reality, as a materialization of mental energy or a sacred vomit that seams to be green or violet with a crystal transformative tubing. It is also I think a river-looking-glass where information and emotion liquefy in vitoastral fluids. Terence Mckenna in his book “True Hallucinations”, speaks of one time when, after he smoked d.m.t. and was with a girl in India, he retched out a very similar ectoplasm which he linked to glossolalia.
Other d.m.t or ayahuasca or tryptaminic users share the same experience.

For this and showing us that we have spaceships in our body and time-traveling machines and the joy of creating through destruction, part of the blue dream, the revolving womb in the sky, Donnie Darko is a Riveron Silver Mirror Hero.

ghost domino snow

2006-11-05T08:41:00.000-08:00

“Felix, qui potuit rerum cognoscere causas”
Virgil

To know the secret causes, understand karma crystally, how energy moves and calls in the distance, to see things invisible, the web that links manifolded worlds.

Do you have a synchronizer? Do you have a vortex machine? Can you measure my ethereal breezing on Andromeda’s hair?

What do your cells think of it, do they like their mirrors? What do your photons want to do now? Maybe go to Hawaii, surf you hand?

The consciousness of a river, of the Nile for example, is it constantly speaking to the Milky Way, spinning the liquid light yarn?

Can it all be same, or many-minded, like I could be seven persons or a waterfall in Alaska, a stone in Lemuria, furniture on a moonsystem in the Pleiades, a triceratops and sweetest alfalfa? And at times we could all be causing each other headaches or a strange reasonless happiness, like when you haven’t taken any drugs recently but you feel high as on cosmic mescaline.

And if so how am i here and also there? behind the mirror and maybe above the stars where one r.e.m.’s and memes the worldself.

Have you ever been in a helicopter inside a Tree an read the Book?

riveron question

2006-11-05T08:35:00.000-08:00

.

Do we believe in mannequins as an option for the future?
Is future what it used to be?
Are we fucked or are we Gods?
.
.

Rainmakers Credo (A Relation of Colorless to Colorful Events)

2006-11-05T08:34:00.000-08:00

lllllll
lllllll
lllllll

Thought of the rain, why does it come when it comes?

Been noticing strange rain conjunctions and felt ion-charges that baffle all charts.

Thought that it is not only rain that falls from the skies.

----------------------------------------

Nobody knows? Meteor-science cannot predict specific storms with the accuracy of other laws. It can see cloud-clusters form before a naked eye through satellites high and low, but can never read the mind of the eye in the sky. It is perhaps ruling nature's last trenchhold, which is next to none.
The right of cataclysm, energy’s secret agenda.

Technicians of the spirit old could provoke grand meaningful showersprouts.

Laymen like u and i can with our thoughts move layers of clouds, if calling loud could for some time enjoy a sunny day, or perhaps ask for the waterlight seed to yield a mushroom for tomorrows rave.

It is certain we are water and like moons we move waves or influence molecule's crystal tides, mandalas inside.

But the mystery remains.

The same mystery of the limits, not only of bodies in physical reality not overlapping, but of thoughts and wavefunctions not overlapping, reamining in their husks the souls, the stars.

Perhaps not.

Can someone stop the plan of a great deluge?

Can someone say to Mother Gaia, hey please, mmm i know you are planning and all out wet exorcism, that the cities will flood, that it is part of your organism’s homeostasis in the dance of chaos and cosmos, but could you spare us a summer for redirection, for bloom, for redemption under the sun?

Still the rain is good for it is sooth.

Still the transparent tiger is the burning lamb.

The lines in the sky, the vertigo posts.

Rain, well my thoughts raid, is a paradox.

Always a yes and a no.

Always a falling that is an up-standing: the cornstalk mirrors the rain-vector.

A gift and a punishment.

Perhaps conciled in consciousness.

A-foxe's raincheck's blind sign.

Comming to terms with something that is and is not.

Like riding rain diaphanous ravens.

Riding that way is understanding that it is sex.

Ionized like Dyonissos falling from apolinean heights.

(Newtons fallen apple gave him the mastery of the skies).

Rain that is so femenine is extremely phallic.

Soft and fierce, so elegant -at times very impolite.

From higher womb seeding lower womb with ghostly snakes.

Hard lysergic rain.

Angelhair.

Kundalini Sprite.

Could we use the rain to get high?

Like Mary-Poppins umbrella/Virgin Mary’s liquid dove.

Asumption.

And divine conception.

Rain that falows leads us into summer Eros.
Like rabbits.

* * * * * * *

Still believe that going through the body there is a rainbow.

river on image: syriuspaladin---fulcanelliegg

2006-11-05T08:31:00.000-08:00

Alice Summer Solstice Eternal Sunshine Wish

2006-11-05T08:30:00.000-08:00

"Why, sometimes I've believed as many as six impossible things before breakfast."
(White Queen to Alice)

Thoughts for summer... or butterflies
breaking the glass ionized
as sky's emissary
of bright day and lucid rain

as the mind breeds airy architecture
for unfolding summer's clay:
pictures that move dreary clouds away
making room for the ventral dream to play

Lewis Carroll, (who also forged the literae mirror-through) dodgy charleston, dreamed of the longest sun, unbeatable bliss
by a river with a girl (Alice, Alcyon) in all that summer could driftbeam.
To him, jabberwocky prince of our kingdom's crystaleye, this gift, for soulstice renowaltz
-and the higher mathematics of love and mirth- a piece of the splintered glass for wishes
vast beacon in the butterfly-staff, out of ash into wind--
the posibillty of sun's unending bash.

SUMMER CARROLSONG

A BOAT, BEANEATH A SUNNY SKY
LINGERING ONWARD DREAMILY
IN AN EVENING OF JULY

CHILDREN THREE AND NESTLING NEAR
EAGER EYE AND WILLING EAR,
PLEASED A SIMPLE TALE TO HEAR-

LONG HAS PALED THE SUNNY SKY:
ECHOES FADE AND MEMORIES DIE:
AUTUMN FROST HAVE SLAIN JULY

STILL SHE HUNTS ME, PHANTOMWISE,
ALICE MOVING UNDER SKIES
NEVER SEEN BY WAKING EYES.

IN A WONDERLAND THEY LIE,
DREAMING AS THE DAYS GO BY,
DREAMING AS THE SUMMERS DIE:

EVERDRIFTING DOWN THE STREAM-
LINGERING IN THE GOLDEN GLEAM-
LIFE, WHAT IS BUT A DREAM?
(Lewis Carrol "Through the Looking-Glass")

....................................................................................

...maybe-butterflies will come
this year speeding like souls
from the sun's athanor
(unlikely if your dream is too busy)
or summer in the city
dappled in moctezuma gold-
perhaps tiger-lily's saying koans
(i want koalafire guns)
and cups flying from the hills of dawn-
dazzling hare in the haze:
the girl riding the unicorn
out of Alcyon.

today the sky stepped up
(which is stepping down,
for us)
azure velvetine cloud-signalings
like happy pregnant zeppelins
whitewashed _history and time
sweetest erazorhead!
caressing the indigo flamingo,
summer pure pouring
the levity wine blue blue blue blu blue glue blue blue glue blue
as summer should
----- a wish for sure

poppies in the street looked marbling
at sunset's twining danae
eyes had tha wings that mirros put
in the cracked kernel, the candy glow
of secret click, the joy
of humming birth
again a choice made
in deepest well
to transform the architecture of decay
(desert city dieoxide omphalos cave)
by dreamspell swaying brand new
Lewis Carrol out of his grave -a day
like he dreamed, like we dream,
to be with Alice on a boat
(our spirits in Anubliss hya-synth )
blazing by a golden stream.

today the sky did swell

(noticed the stairways?
in between the spaces
like the thoughts of a goddess
in her Nintendo heaven
undressed to all virtuality,
the velvet undergown)

of choice to clasp the aether

of spiders glass helping us in our exams

not answers but smiles
in their lattice

(maybe this year the smile of the summer cat
will stay when the summer goes away)

just nets that let us

the only lent is the invisible hand

archway that seams himself high

leaving then us the mirror chance

from summer's blue machinery
to ancient new connection
tread tha path of the crystALICEsation
and rest your head in the sky

as alec boy responded:

"As an unmuddied lake, Fred. As clear as an azure sky of deepest summer. You can rely on me".

for impossible things
blowing our wits
on jabberwocky wings
the jestering alchemy

*********************************************

Happy Soulstice
Happy Summer
Riveron
Turn the way around
Flow into the sun

her thoughts are inside a winter solstice (this instant)

2006-11-05T08:29:00.001-08:00

a bit of vitriol for the longest sun of the year -----

2006-11-05T08:28:00.000-08:00

ELECTRUM MAGICUM (just try to conceive the mirror)

2006-11-05T08:25:00.000-08:00

.

door = key
.

(if you're able to imagine the door, you'll already have the key... .
.

. .
.......................................................................

riveron summer starship

2006-11-05T08:24:00.000-08:00

Find your tickets inside any mirror!!!

skin design key

...riveronrevolution...

.

.

.

SOROR MYSTICA

2006-11-05T08:16:00.000-08:00

The feminine ethereal presence behind the prism of occidental knowledge.

Soror (ether - patcha mamma) with her mare’s hair dress.

Once mother
Once lover
Once lotus
Once gaia

thank you for permanent crystal advices
…. Like the white owl swamp (silence): you talk to me with infinite love (silence), you are my partner trough rivers and mirrors

… unlimited warmness for the warriors who follow possibilities,
it is said to be…

as liquid bluemoon silver,
energy performance,
gathering jaguar,
and every consciousness has its own guardian,

it is a motley sky, quantum road, spiritual oven

Mother? ..is it the uterus’s soul who’s calling me?

00101110110000110001011101

…. Like sacred text underneath my belly

Visiting the interior of térrea in search of oculta lapidae
(invoking talisman nickname)

(her milk as God’s mandalic inflow)
evening’s breathe
I hear her steps everywhere
feedback breasts
inexplicable teachings

lily’s lilt,
limpid motionless
(liquid libélula)

a gaze to the rabbit
a jade riddle
a raw fractal
couple of black coral eyes

: forever witness the masterpiece

she is omnipresent, no fences facing us
(she visits every atanor´s work)

the infecund process won’t meet her

mercurial vagina:
(silver jesus lips)

ninja garden rain

2006-11-05T08:14:00.000-08:00

labyrinth (liquid)

!!!!!!!!
!!!!!!!! rosamundi
!!!!!!!!

mirrotaurus

En los dias de lluvia ---podria atravesar
luvial (lightbull) la lluvia - bubulubu lavulva
congelada grial ya salvia via de la sal
hacia el diamante - o la zancada del ocelote
zenzigzag en siga la ciudad -- la selva
laserlabia o sandalias mjrain - (sapphire zanja)
de jade lustral la barda el diagrama la ceiba digital
meta geometria euclidiana lancoleada hiperdimensional
la bala congelada --- la luz solida
el cristal - esquivar al guardian
la taiga dulce del abedul - su falange
de angeles - la flauta magica
de wagner la - selva - blanca
salvas de bengala like derzu-usala
---- el tigre invisibledarma
el castillo de kafka - la vigilancia
virgilio de liquidambar --- siete prana
aire de shambala --- barda de shangri-la
great savannah siete mississipi
siete venus siete sirius blitz
blizzard hail mary - pass - whiskey bar
las lineas consteladas de la ayahuasca
el rio vertical los rios y el delta solar
en la lluvia geodesica el cordon umbilical
los espermas de plata centinelas ---- usumacinta
latviafenix frontera de transparencia
coordenada o granada - el agua
las agujas - la muralla - samurai sutil
el desliz - el filo de la obsidiana
cielo y tijeras - lluvia y puma
zeus y silfides zeus y danae - zero
entre los unos entre las barras senderos
hurakan corazon del cielo - agujero
en la inhalacion de la nube de hierro
flechazul gacelazul gracil arcaduz
violacea ablacion (twi-light)
-- cicatriz en el sombrero
de merlin tri-neo beatifico tragaluz
y el relampago del trapecio --- el medico
rosacruz aereo argonauta -- el vellocino
mas alla del velo de la lluvia
y la gabardina cerulea de maia
la luna aurea lapis veritas
o manzana hesperida de la duermevela
la vereda secreta entre la lluvia
y la magia --- nymphaea
--- orquidea --- vainilla
traspasada la lluvia
____________________ intacta
la vela--la vaina ^
<<<<<<<>>>>>>
VULVA DEUS
^
v Magdalena

FROM The Myriad Salad Reef

2006-11-04T21:47:00.000-08:00

A Green Bestiary

"It is certain that fine woman eat
a crazy salad with their meat".
W.B Yeats

*

Lines in the grid are green, but not to eat.

*

Food must be, she says, an ethereal entrance.

*
Thoughts in the screen straydog looking
for sooth. Wanna be happy eating salad solo
like a fool in the hill, enjoying the silence, taking deep breaths,
eat the world sovereign.

*
Frog could be god if it were called dog (sorry Stan).

*

Notice that there are wires in the plate, hairs faintly femenine,
notice that there are faces forming, memories in the wilderness,
whispering.

*

The antilopes doom is that it loops

*

Notice novia supernova, notice the moustache of a funny mustang warrior,
notice mustard calling for wanton gold. Notice invisible birds sharing the dressing
and warbles of world and flying together remotely true, like daydream in school.
Notice a lace, a white bonnet, a flower. A chance of garland and vegetable paths in the sky.

(mayhap that mind -mayhappy- would like to climb
the lines (as there is no end to a mountain but climb)
for what is to fly? but perhands to cling
to instruments from stars, sweet violaser from the Crab,
waterfall harpischord from the Swan, can you softly brush
the silver string of sea and moon when u-abyss,
like Geronimo, that to cloud is floating horse?
In regards to flying that perplexed angel of playing,
when eating sacraments is choir. A green chance,
like the march-hare, lettuce-teeth, or mushroom
spin, that digs a hole in lapislazuli, cloves to moon
and sinks in, from carrot rocket or caring food.
Makes place in higher space from pulleys and latch,
the cabbage jettisoned waltz of calling match.
Mirror cable-finger, mirror wing-rib,
upheaves from the pin gettin in.
Or a sort of design of beads or rootless
leaves synched by pole, cluster or stalk.
That to levitate is to find a hook where your nose
can breathe sunyata and dakini mint.
That invisible rope the snake used
to the stars calling it bird.

*

I thought a greenhouse effect would be cool,
i like parties in haunted houses where glow-in-the-dark girls
candyflip and grin at ghosts that could be me.

*

One of the most beautiful skies i saw was emerald green,
it was a grassy mirror of siesta dreams.

*

In my dream a blue deer held an eternal sun
over a dissolving hill.

*

Deerdived (died) but eternal rised for sun dyed
sailing keys: that transformation is the stillness of being,
all remainings a rainbow yielded trick, so
sun pale green in the ground, naked feet desertsea,
a medusaspring, molusc-like in cactae guise,
seeming is appearing in parallel coral,
LOPHOPHORA WILLIAMSII he sprang to say hi!!!
little antler coils cricket my eye
the little hikuri fountain,
sun or babydragon,
where from marriage of spirals,
thelema tells a truth
for in my dream kernel
can eat the key to wake
from eternity into a river.

*

To me mercury, modify.

*
The marakame said "in my lineage all flowerdum fronts,
my own, turn into deer popps, but oh how would i dream
to become a wolf that runs away from the fire-circle-song,
and roams alone".

Tired perhaps of that old same-old song, if only we would create
without stepping stone, the runaway gold.

*

Hamlet said " Bounded in a nutshell I could count myself king of infinte space",
past, perhaps, past spies, visitors from outerspace, scratchs,
windowpanes, institution bells, Ophelia cries, Orpheus's laments,
King of a Blackhole-Sun, divinely, exactly, mad, knowing the hologram,
in the rabbithole, flyingsolo in the silence of his father.

*

The Shoplifter after many runs or crescendos of bold champagne on the keepers face, comes to realize
that it could be his shop.

*

Plucked the golden bough.

*

Hamlet and the Marakame meet at the crossroad of autosky and join to say
" Lets go back"
" We could start a war"
"Kill the king"
"Eat the sun"
"Say a lie"

*

Ennui, melancholy, stop. Go to the store.

Paranoia wolf, potato.

Crazy ham.

Bring me a chocolatebar withe name of a star.

I wanna rest in the first microwave, burrito zar.

Goodbye, i found a vortex in myself.

If the sun was not made of butter, this war could stop.

Sinsemilla is not possible. (fuck dont i believe more in the egg).

Everything is vain.

Can you laugh at your mask.

Or bake an apple-pie without the universe.

I always thought riding ferrari-cliches that monks would come to the store
and parade in thrash and sodapop and show you bliss and satory and carelessness,
for cherry and not either/or, girls that would come with them following their robes,
in a wink of the eye at the register for paradise is everywhere.

And all you could utter, surmounting the whole of your beings was "could you pass me the lighter".

*

Throw around the greenEris in the kitchen synch, the waffle warp spacekiss.
Spinach silk. seal spinal chords with forking frogs. Rub muffindub. morphine maidday.
Secret airplane. silverspoondream. House of Surprising Herbs, flying dates. daisy dazzling gate.
Reefer Decrees.

*

Axis-mundi in the salad secret pulse.
Axis -mundi in the store behind superstar candy.
Axis-mundi in the body where you would connect the gadget.

For flying tree, for flying weaved
for eating deep, sap blood light
and climbing inside
quartz planet star

axismundi jellyfish
in the the plate near gazzelles bursting cells
and blue deers quetzalads grapes silence
near fingers photons skypole telephers
or buttons green strings of float on
(omphalos coopt the laser lady's code)))
play start zap surf multiple choice spider
the arm remote dappled by incipient
gossamer glowing fairy joints

like blue cheese sauce

scattered
over a green hill
or a green belly

blue cheese like freckles
on the face of a flying saucer

or feathers of another bird

scattered

the girl

the grid

the lock

Secret River Story

2006-11-04T21:31:00.000-08:00

And this prince was called Alamut and was Mohammedan. He had created, in a lovely valley enclosed between two very high mountains, a beautiful garden, full of every variety of fruit and trees that could be obtained. Round these plantations were various palaces and pavilions, decorated with golden ornaments. He had brought in young girls of perfect beauty and full of charm to live here, paintings and furniture all made of silk, and they were trained to sing, to play all sorts of instruments, to dance, and above all to make the most seductive advances to men that can be imagined. This is the reason why the old man had this place built, Mohammed having said that those who obeyed his will would go to Paradise where they would find all the pleasures and delights of the world: beautiful women and rivers of milk and honey, this man wanted to pretend that he could make anyone he wished enter this very Paradise. No-one could penetrate into the garden we described, for they had built at the entrance to the valley a very fortified and impregnable castle. It could only be entered by a secret road.

-Hakim Bey, Hashassin and Axiom Prince

from the Coil Conundrum

mead ensemble of the vault bonfire
in deepest Portia levitated hill
or Ariadne's reel
of doors eaten by ivyfish
where medusahair wrings

Are couples copulating?

2006-11-04T20:53:00.000-08:00

Chaotic faith seems fading

Monochromatic sexual structures:
but where is the sexo lúdico?

New moon
Luna nueva
Spirit nova

Crystal puppet --------------- seems quite vulnerable.

Amber Jacuzzi --------------- no vampire ladies allowed

Living animal --------------- wildly dance around our necks

Lubricated road -------------- like chrysanthemums freeway

Jeweled nights ------------------ 1001 infinites and so on..

A servant’s portrait --------------- gentle prism and no dark side

Japanese skirts ------------------ college highlights and sky keys

Sexual nostalgia ----------------- is everybody in?

Sweet but scare ------------------ the almost logic girl

Kingdom of no-more ------------- Isness has to be

Seven alephs ------------- …at least, not at last

Profane ways-words ------------- baby, don’t give info to the system

One color insanity ------------ Eddie murphy’s white teeth

Cellular orchestra ---------------- sights and sounds of a northern witch

Cultural sex -------------- It is the ghost machine of abstractions

Severe nights and toughts

Three evil entities are blocking our astral destiny according to Terrence:
Lady Hegemony
Lady Monotony
Lady Monogamy

A collective soul escape is needed (spinning the planet) aqua mellow

A gentle androgyn smiling

Lets play with thighs, lets find the friendly nectar of our sincere partners:
Mr. Phallus,
Mrs. Vagina
And
Mr. Blue sky

Do you see the golden chamber on top of the north tower (as a liquid cave mirror)

Transparent porn furniture

Daydreaming is not fancy

Key you ki

- Where are mamma and pappa?

Warm up the precious stones, caress the jade and the emerald.

Carnal (corporal narrative)
Dualite reunion
Ethereal (the spirit within the body)
Dualite reunion

Moral blocking the path
Depravation fading it out
Warmness being insufficient (quantic sometimes)

We shall never give up the fight
Copulate the miracle mirror
mercury

river on revolution

riveron friend: David Bohm

2006-11-04T20:44:00.000-08:00

David Bohm american born theoretical physicist (December 20, 1917 Wilkes-Barre, PA–October 27, 1992 London, Uk) author (or discoverer) of an extremely elegant model of the universe that tunes-in with the deepest intuition of undivided wholeness. He is undoubtedly the foremost figure in what is known as the holographic paradigm, a shift from a ratio-mechanical worldview into an all-inclusive perspective of the world as an interconnected whole where, as in a hologram, every part contains the in-formation of the entire photograph or universe.

" a hologram reveals how total content--in principle extending over the whole of space and time--is enfolded in the movement of waves (electromagnetic and other kinds) in any given region."

“All the worlds whirl in a grain of sand”.

"light is the means by which the entire universe unfolds into itself.

Bohm is like the priest of the future, that weds back science with religion and art, that looks more like the past, riding the spirit of present times, weaving together rigorous episteme with resonating fractal intuition.

David Bohm wears Indra's jeweled net on his neck.

As a child Bohm experienced the call of the secret in the woods and developed an unquenchable drive to seek for the hidden cause of things. (He later developed the hidden variables theory).

Like Blake and Einstein, Bohm pre-emphasized imagination as a way to attain knowledge. In this way empathizing with the deep order lying within -the creative and dynamic process of consciousness unfolding into manifest reality.

Bohm faced persecution for alleged communist beliefs which led him to exile. Later he faced collegiate dissaproval and tagbearing which deemed him as more of a mystic than a methodistic scientist. However Bohm remained true to himself. Working the out-of-bounds akash with dandy math.

Some of Bohm’s friends and associates where: Albert Einstein, Oppenheimer (Bohm refused to particpate in the Manhattan Project), J. Krishnamurti, Stan Grof, Karl Pribram, The Dalai Lama (Bohm was his personal physics teacher).
,
Bohm is widely regarded as a good guy, always humble and willing, he is ,like the taomaster an "oldboy", who dug the void for impersonal surfgold.

Early in his career Bohm confronted the ghost in the machine, adressing the primordial task in modern physics, the evident contradiction between quantum mechanics and relativistic theory. In a way an older dilemma, the dualistic paradox: that of fluid motion and stillness, that of the One and the Many, cause and chance, mind and matter.

For this he came up with his theory of an Implicate Order that unfolds into an Explicate Order through an all-pervasive holomovement or:

“the unbroken wholeness of the totality of existence as an undivided flowing movement without borders”

“In this flow, mind and matter are not separate substances. Rather they are different aspects…”

perhaps like dreams and reality…

The indeterministic and “spooky action at a distance” of quantum physics resolved into a non-local, causal and panpsychic universe where randomness is but the contextual expression of a deeper order.

For Bohm the world we perceive is but the ripple on the surface of an implicate order that underlies as an ocean of energy, where, if we delve into the vacuum or zeropoint-energy, we find that “ a single cubic centimetre of empty space contains more energy than all of the matter in the known universe “.

From this unfathomable depth spring subatomic particles:

“fundamentally, the particle is only an abstraction that is manifest to our senses. What is, is always a totality of ensembles, all present together, in an orderly series of stages of enfoldment and unfoldment, which intermingle and inter-penetrate each other in principle throughout the whole of space".

In that sense all the billions of billions of electrons distributed throughout space are but one same electron which unfolds from an ocean of quantum potential, in truth inseparable from its source like a wave is inseparable from the sea, and as it reaches reality’s bay it carries the whole of the sea at a particular place of time- this is the collapse of the wavefunction, the break of tide, deeply unbroken.

The electron cannot forget the unity that conforms his being…

The electron has complete and instant acess to cosmic internet…

The electron confirms this by acting like a highly evolved multidimensional miniastronaut.

This could explain such strange phenomena as quantum entanglement or quantum superimposition, where (faster than light) instantaneous communication takes place or a same particle is at more than one place at the same time, when all particles are part of a great and subtle body that extends its edges into apparent and ilusory oblivion.

Can we imagine all things already connected, without the necessity of wires or emissions, without traveling an angstrom,
knowing and experiencing everything the other knows and experiences?

This is where thought cannot go. This is where suffering comes from.

It is also the point of the cosmic play, the mystery:

"Of the mystery? I think you could see it like this: that if you look into the field of thought and reason and so on, you finally see it has no clear foundation. Therefore, you see that "what is" must be beyond that. 'What is' is the mystery. (Bohm and Krishnamurti).

David Bohm saw the connection where the implicate order knits with the explicate order as a kind of pier inviting us to dive beyond into the depths of a mysterious holocean..

... and if we knew how to access, "tear the veil" of this superquantum interlocking aleph of holographic projection we could find "Andromedas galaxy in our fingerprint", see the past and future in the crystalball of a molecule of air, the rise and fall of worlds boiling in a puddle...

* ************************************************ *

U are already part of the waves of light that make up the hologram, but the hologram has been systematically fragmented so u can only see a blurry image, making it difficult to recognize your face forming everywhere...

Bohm believed that fragmentation was the main cause of cultural discontent, reality being considered objective ( sacred) and separate from consciousness. Being in truth the otherway around: consciousness creating reality, for mind cannot but unfold reality being part of the same flowing whole and sharing unyieldingly the creative backdrop of the implicate order.

Bohm pointed out that both science and thought limit us in our approach to the immeasurable whole, sharing the vice of forming a world of their own in which they are everything, reifing and imagining that there is nothing but what they think about themselves and what they think about. A self-contained narcissus-narcosis.

“Through freeform dialogue it is possible to reestablish a genuine and creative collective consciousness”.

"Deep down the consciousness of mankind is one. This is a virtual certainty because even in the vacuum matter is one; and if we don't see this, it's because we are blinding ourselves to it."

For wiring deep into the mirror who’s name is Unity

For setting in motion the river that flows without division.

For giving being to meaning -the metaphor of our times: the hologram.

David Bohm is a river-on friend.

Before and After Science: Global Conciousness Project

2006-10-14T17:54:00.000-07:00

.

“Thy spirit shall ride digital waves”

19th century anonymous.
.

.

GCP is a collective international effort of various disciplines, it involves the contribution of scientists, artists, engineers, and programmers. It's main purpose is to investigate the physical effects printed by the collective human consciousness. This project keeps an intimate relation with Teilhard De Chardin’s concept of noosphere.

--- the permanent manifolding of universe towards integration... ---

“A global network of electronic devices produces continuous random data sequences. Subtle patterns in the data are linked with events that cause shared thoughts and emotions in millions of people. The results challenge common ideas about the world, but independent analyses confirm the unexpected patterns, and also indicate that they cannot be attributed to ordinary physical forces or electromagnetic fields.”

“The Global Consciousness Project is an international collaboration created in 1998 to study the subtle reach of human consciousness in the physical world. We maintain a network of random event generators (REGs) with nodes in more than 50 locations, from Alaska to Fiji, on all continents, and in nearly every time zone.”

Penetrate the GCP visiting: http://noosphere.princeton.edu/

.

river on friend: Roberto Baggio

2006-10-14T17:48:00.000-07:00

Born (feb. 18, 1967) in Caldogno, near Vicenza, north of Italy.

.
..........................................
Fore some people, he is considered the finest player in soccer history.

Awarded, in 1993, with the FIFA’s World Player of the Year and also the Ballon D’Or.

He began his carrier with Vicenza, in the italian serie C1, 1981. He played there until Fiorentina took him to the Serie A of the calcio. During his five years with this team, Baggio became a divine figure among Fiorentina’s fans. In 1990 he was transferred to the Juventus in a world record transfer: 19 million USD. With this squad, Baggio reached his best moments as a soccer player. After wining a scudetto with the Viecca Signora he went to play with Milan, Internatzionale, Bologna and finally Brescia, where he retired in 2004 having scored 205 goal in the Serie A. This made him the fifth highest scorer in the Italian league’s history.

Baggio published an autobiography titled “Una porta nel cielo”.

His spiritual life has been devoted to the Soka gakkai Budhism. This has been a crucial element in the development of his luminous professional carrier. It seems that Baggio clearly understands the relation of magic and soccer, the potential spiritual conjunction between time, space, rhythm, clarity and intention.

With winged feet and ludic elegance “Ill Divino Baggio” plays with the mirror, here we consider him as a teammate: as a riveron friend.

river on friend: Nicola Tesla

2006-10-14T17:46:00.000-07:00

-
-

"Universal peace as a result of cumulative effort through past centuries might come into existence quickly - not unlike a crystal that suddenly forms in a solution which has been slowly prepared”.
-
-

Western master - alchemical electricist.

1856-1943
Serbian born electrical engineer, he saw his first light at midnight, during an electric storm in Smilijan, a mountainous village that is now part of Croatia.

He arrived to the US with 4 cents in his pocket, some of his poems and a series of ilustrations about flying machines designs.

Considered as one of the most important contributors to the scientific development in electricity and magnetism, and the greatest electrical engineer. He’s also famous for designing a system that lead to the creation of worldwide communication with artifacts such as radio, fax and radar.

Among his most important inventions we can find:

X-rays
Vacuum tube amplifier
Fluorescent bulb
Neon lights
Speedometer
Automobile ignition system
Electron microscope
Microwave oven

"The chief cause of war is the vast extent of this planet. The gradual annihilation of distance will put human beings in closer contact and harmonize their views and aspirations."

Tesla
Pop-metal band formed in Sacramento, California, in 1985.

Nikola Tesla (1977)
Tv series by Eduard Galic, Yugoslavia.

- Cinema

Tesla ’76 (1977)
Yugoslavian short film (documentary) by Nicola Stankovic.

Tesla: Tripping the light electric (2000)
By Lance Acord, USA.

The Visionary (2005)
By Joel Shapiro, USA.

Tajina Nicole Tesle (1980)
By Krsto Papic, Yugoslavia.

The legacy of his geniality is printed in today’s daily use on many electrical devices. His work eventually represented fundamental contribution in deferent fields such as robotics, computer science, nuclear physics and electro-domestics.

It is said that Tesla worked with time-travel technology. Some of his studies have been used in different space projects over the last decades.

Free electric energy for everyone was Tesla’s most profound desire. He even created a special panel that’s serves as a homemade receptor of energy. It’s built with very cheap materials and with not necessary knowledge in electricity matters.

"My wireless transmitter does not use Hertzian waves, which are a grievous myth, but sound waves in the aether..."

For his epic electrical rivering, Nicola Tesla is a luminous riveron friend.
.

literary movieteaser (riveron contribuition by Osiris Luciano)

2006-10-14T17:45:00.000-07:00

[the blue stars above
as we build below
seven sisters
forever in our mind
--lets cluster]

•K

(a film in preproduction
dedicated to the eternal female archetype
and the dawn of mirrors and laughter
and kundalini)

what follows is a poetic teaser
translation of the plotline and the imagery

soon in theaters near u

....---....-....-----......
...---...--...----....---

*
darkest black dna silence now
----being human--------
and the nine moons revolving:
yousleeping at the womb.
Bluelight of the Caribbean
---the sound of reality,
being
a boy
in Mayan lianas-
to be free
and wildly
innocent.

the death of my makers
---ash eagle---
who am i now?
i live where the snake
bites its egg,
i am in the city of the iris navel.
we are in Technotitlan.
the volcanoes fume sweetly,
the ufo's heaven at the door.

...from Maia to Gaia. always. the mothership.
goddess-girl, the sound of a crystal harp.
wordless. transfixed only by her,
she teaches us to dream awake.
i dont look , i dont desire her.
fire kindles again.

someone talks, its my river reason: i is another.
we are imagined beings conceived by unimaginable others.
your friend springs and co-creates reality.
how am i not me? do you feel time ending.
not anymore.

i am unconscious, only dream is real. she asks me in.
to tear Isis’s veil and enter her reflection.
language inside silence, the power of thought.
feelgood with the girl, she looks at me the same way.

your friend dreams a kite in the sky, gets to you.
he only remembers how it slipped away.
will becomes purpose. rapport from beyond.
in worlds awakened. if you fall asleep i'll wake u-up.

we are kids, we believe fun comes first,
yes, we are strange, our dreams are our school,
we respect the Earth's pledge and the Stars too.
now we weave a doorway into the Pleiades.

a song a smell a kiss from mused air, you are there.
whats the point? if i could be someone else
Id be a jade blade cutting chocolate for her.
dolphins are from Sirius. beer is born in the sun.

i am layin down in a lab etherized, analysed.
a doctor fathoms my breath and imprints my pulse.
a deutronic camara decodes my genetic spiral.
my body becomes a hologram, I look at u
from the other side.

now i remember, now i learn, now i see.
we are morphing, i am not the only one.
(out there butterflies begin to crash
into the galaxy's pharmacy).
what am i doing, trapped by a crazy fool.
who traps who? he wants my genes,
the burning snake in my kernel.

what the fuck is this?

i am the sea of my genes driving
my being unto her. could i have dreamed
the unborn daughter of timeless echo?
who am i speaking to? who is that girl?
i dig her. i am someone who dreams he is
everyone. awaking the warrior night.

i am unborn, i still slumber in the mother foam,
am i dreaming that i am a phoetus and and it is my
flight to be a photon and build a city of quartz?
i only recall her eyes, i like it when you look at me
and then fade fast in the looking-glass.
we are free now.

i want to wake up. dont expect anything.
im on my way. i reach the doorway were you wait.
the door is not what i thought. the door is the same
as u. the rainbow bird and the mirror are borne again.
day and the sun's rebirth.

you are at the eye of thirteen flinstone mirrors.
the harp flickers, the seventh string. joy numinous.
the sound of a-hummingbird. your soul
returns to your body. be still,
conscious of this moment.

something is about to unravel

you are about to wake

the silver light pierces through

triple helix blaze

she's there.

so, do u have any plans for today?

the river sounds on: Terry Riley

2006-10-14T17:43:00.000-07:00

.
.
.
Born in Colfax, California, 1935.

This revolutionary composer proposed new ways of exploring the artificial labyrinth of sonoric patterns. Electric mantras cyclically weaved in search of transcending the usual dimensions of recorded sound. He is considered as one of the most significant contributors to the creation and development of minimalist music, which was based in a mixture-distortion of serialism, indeterminacy and, over all, (a)tonality.

During the 60´s and 70´s, Terry Riley became famous for his “all night flights” which included sonoric improvisations of Riley’s organ harmonium and tape-delayed saxophone playing non-stop sessions that lasted from eight to twelve hours.

Influenced by Karl Heinz Stockhausen, Riley has worked, among many others, with La Monte Young, Steve Reich, Rova Saxophone Quartet and John Cale. Big league musicians like Philip Glass, Toru Takemitsu, Kronos Quartet and Scratch Orchestra, have performed his compositions.

Pandit Pran Nath, probably the most respected Raga vocalist, is considered his most influential teacher.

He has composed around nine quartets for the Kronos Quartet.

In UC Berkley he was a classmate of L. M. Young and David Del Tredici in a composition class.

He masters different acoustic instruments like violin, piano and saxophone.

His second album, In C, written in San Francisco, is considered a masterpiece in the musical stage of the twentieth century. This work was an interlocking of 53 different serial patterns that Riley had previously composed for this purpose. In his own words: ”In C, it’s a psychedelic cosmic opera. It should be heard as a very expansive experience”.

These are some of Riley’s most important works:

In C (1964)
Poppy Nogood and the Phantom Band (1968)
A Rainbow in Curved Air (1969)
Church of Anthrax (1971)
Shri Camel (1980)
The Descending Moonshine Dervishes / The Ten Voices of the
Two Prophets Celestial Harmonies (1983)
The Harp of New Albion (1986)
Salome Dances for Peace (1989)
Chanting the Light of Foresight, (1994)
Sun Rings (2003)

“I feel that music is a way to separate our selves from the material world. Listening to music is a kind of prayer and it’s all you really need. It connects you with the spirit of creativity… In India it’s hard to separate them because music is still deeply rooted in religion, in devotion, and music is considered a religious path… There’s all kinds of music and all kinds of ways to listen to it, but essentially, music is something of the spirit.”

River on Riley’s sounds:

Because of his deep-sonoric mandalas and his geometric electromantras, the river sounds on Mr. Terry.

.

mirroring image: kiss my soul...

2006-10-14T17:42:00.000-07:00

river on lyric

2006-10-14T17:34:00.000-07:00

---Syd Barret---

(
still piping at the gates of dawn
hope u cross that "other" mirror)
) ) ) ) ) ( ( ( ( (

"Flaming"

Alone in the clouds all blue
Lying on an eiderdown.
Yippee! You can't see me
But I can you.
Lazing in the foggy dew
Sitting on a unicorn.
No fair, you can't hear me
But I can you.
Watching buttercups cup the light
Sleeping on a dandelion.
Too much, I won't touch you
But then I might.
Screaming through the starlit sky
Travelling by telephone.
Hey ho, here we go
Ever so high.
Alone in the clouds all blue
Lying on an eiderdown.
Yippee! You can't see me
But I can you.

---

river on deity: Xochipilli

2006-10-10T19:56:00.000-07:00

.
.
.

“Prince(ss) of the flowers”

God of love, dance, flowers and games.

He represents an intersection between the divine essences of the ludic, the magic and the tenderness dimensions.

Related to life, earth and fertility. Symbol of the rising sun.

Creator of flowers.

She has a precious stone representation in the Museo Nacional de Antropologia of Mexico, in which she appears covered by sacred plants like tobbaco, ololiuhqui, sinicuichi and different kinds of divine mushrooms.

Although it is officially considered as a masculine deity there are strong versions that suggest its feminine nature, maybe an androgynous one.

Know her, love her.
Play with the floral mandala, feel the fertile love, embrace earth with your infinite magic and praise the prince(ss) of flowers:

...
peel
Xochipilli’s .
pill
...